hAT-N1a_Mam
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0001245 |
|---|---|
| TE superfamily | Tip100 |
| TE order | DNA |
| Species | Eutheria |
| Length | 362 |
| Kimura value | 31.23 |
| Tau index | 1.0000 |
| Description | hAT-Tip100 DNA transposon, hAT-N1a_Mam subfamily |
| Comment | Incomplete at 5'end where the consensus runs in a simple repeat. Orientation may be the other way around. |
| Sequence |
GTGTGTGTGTGATGAGGATTAAACNGTACATGGTATCAGGGAAAACTGTCGACATTGATGCTGATTATAGATACTGGAGAACTAACAAAGTAAGAAGAGAAAAACTTAAAAATGCTTGGTTTGGCTGTGTAAAAGTAATACTAATTACAGTCATTTACGTGAACTGCTTACCATTTATGCCTAATTACCATGCAGCACAATAACGATTATGCATATCATTAAATATGTGTCAGATTAACTTTGTTGTAAGTTTTATTTGATTACAACACTAAACTCTGTTCACGTATGCTCAGTCTTCATAGTTTGTTGCTCATGTAGCATGGTCGTCTGCTCACAACTTTAAAAAATTAGAGGGAACATTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| hAT-N1a_Mam | RLM1 | 59 | 72 | - | 4.75 | ATCTATAATCAGCA |
| hAT-N1a_Mam | ZNF157 | 153 | 173 | - | 4.56 | TGGTAAGCAGTTCACGTAAAT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
