MIR1_Amn
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0001253 |
|---|---|
| TE superfamily | L2-end |
| TE order | SINE |
| Species | Amniota |
| Length | 230 |
| Kimura value | 29.82 |
| Tau index | 0.6159 |
| Description | MIR-like SINE. |
| Comment | - |
| Sequence |
TAGGGAGGCAGTGTGGTCTAGTGGATAGAGCACTGGACTGGGACTCGGGAGACCTGGGTTCNANTCCCGGCTCTGCCACTNGCCNGCTGNGTGACCTTGGGCAAGTCACTTNACCTCTCTGNGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATGATACTGACCTCCTTTGTAAAGTGCTTTGAGATCTACTGATGAAAAGTGCTACATAAGAGCTAGGTATTATTAT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MIR1_Amn | ZNF382 | 147 | 170 | + | 3.56 | TGGGGATAATGATACTGACCTCCT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
