AmnSINE2
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000068 |
|---|---|
| TE superfamily | Unknown_LINE-dependent |
| TE class | SINE |
| Species | Amniota |
| Length | 358 |
| Kimura value | 34.72 |
| Tau index | 0.0000 |
| Description | Aminiota SINE2 |
| Comment | The copy number ranges from ~100 in the human genome to ~178 in the chicken genome. 45% of human copies are in highly conserved regions. Shows distant similarity to Leu tRNA. Tentatively classified as SINE element. Inverted from UCON3 original. Reference coords 1-78:tRNA-Leu- TTG, 137-264:Deu core, remainder must match an as yet unknown LINE. |
| Sequence |
GCCGGAGGGGATGGCTTAGTGGTCTAAGCATCAGGTTTGAAATACCTAGACTCCCTGGAACCACAGGTTCAAATCCCAGCAGGGTCGACTCAGCCCTTCATCCTTCCGAGGTAGATAAATTGAGTNCCACGCAGTTTACTGTGTGNGGGTCTTTCGGATGAGACCTTAAAAACCAAAGCCCTGTCTGCTCTGCGTGGACATTAAAGATCCCGTGGCGCTTTTCGTAAGAGTAGGGGTTTGCCCCGGTGCCCTTGGCCGAATTTCTGGAACCCGGCTGAAANCCCGGGGAAACCGAGAGCCTGGCTTATCCCTATAGGGTATTAGNCACCCTATAAAAGTTAAATTTATTTATTTATTT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| AmnSINE2 | YPR196W | 284 | 292 | - | 12.13 | GTTTCCCCG |
| AmnSINE2 | TFAP2E | 1 | 9 | - | 12.06 | CCCTCCGGC |
| AmnSINE2 | Runx1 | 58 | 66 | - | 11.97 | CTGTGGTTC |
| AmnSINE2 | SWI5 | 75 | 81 | - | 11.87 | TGCTGGG |
| AmnSINE2 | Zm00001d024644 | 303 | 310 | + | 11.84 | GCTTATCC |
| AmnSINE2 | ARF27 | 181 | 188 | - | 11.75 | GCAGACAG |
| AmnSINE2 | FOXD2 | 346 | 356 | - | 11.75 | ATAAATAAATA |
| AmnSINE2 | ZNF667 | 159 | 169 | - | 11.74 | TTAAGGTCTCA |
| AmnSINE2 | TFAP2E | 1 | 9 | + | 11.73 | GCCGGAGGG |
| AmnSINE2 | TOE2 | 105 | 112 | + | 11.73 | TCCGAGGT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
