AmnSINE2
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000068 |
|---|---|
| TE superfamily | Unknown_LINE-dependent |
| TE class | SINE |
| Species | Amniota |
| Length | 358 |
| Kimura value | 34.72 |
| Tau index | 0.0000 |
| Description | Aminiota SINE2 |
| Comment | The copy number ranges from ~100 in the human genome to ~178 in the chicken genome. 45% of human copies are in highly conserved regions. Shows distant similarity to Leu tRNA. Tentatively classified as SINE element. Inverted from UCON3 original. Reference coords 1-78:tRNA-Leu- TTG, 137-264:Deu core, remainder must match an as yet unknown LINE. |
| Sequence |
GCCGGAGGGGATGGCTTAGTGGTCTAAGCATCAGGTTTGAAATACCTAGACTCCCTGGAACCACAGGTTCAAATCCCAGCAGGGTCGACTCAGCCCTTCATCCTTCCGAGGTAGATAAATTGAGTNCCACGCAGTTTACTGTGTGNGGGTCTTTCGGATGAGACCTTAAAAACCAAAGCCCTGTCTGCTCTGCGTGGACATTAAAGATCCCGTGGCGCTTTTCGTAAGAGTAGGGGTTTGCCCCGGTGCCCTTGGCCGAATTTCTGGAACCCGGCTGAAANCCCGGGGAAACCGAGAGCCTGGCTTATCCCTATAGGGTATTAGNCACCCTATAAAAGTTAAATTTATTTATTTATTT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| AmnSINE2 | Zic2 | 75 | 83 | + | 15.14 | CCCAGCAGG |
| AmnSINE2 | Hsf | 262 | 269 | - | 14.43 | TTCCAGAA |
| AmnSINE2 | HSFA6B | 262 | 269 | + | 14.34 | TTCTGGAA |
| AmnSINE2 | hsf-1 | 262 | 269 | - | 14.34 | TTCCAGAA |
| AmnSINE2 | HSFC1 | 262 | 269 | - | 14.24 | TTCCAGAA |
| AmnSINE2 | Zic1::Zic2 | 77 | 83 | + | 13.93 | CAGCAGG |
| AmnSINE2 | Zic3 | 77 | 83 | + | 13.70 | CAGCAGG |
| AmnSINE2 | MAZ | 3 | 10 | - | 13.67 | CCCCTCCG |
| AmnSINE2 | Zfp809 | 73 | 81 | + | 13.38 | ATCCCAGCA |
| AmnSINE2 | D19B | 312 | 323 | - | 13.31 | TAATACCCTATA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
