AmnSINE2
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000068 |
|---|---|
| TE superfamily | Unknown_LINE-dependent |
| TE class | SINE |
| Species | Amniota |
| Length | 358 |
| Kimura value | 34.72 |
| Tau index | 0.0000 |
| Description | Aminiota SINE2 |
| Comment | The copy number ranges from ~100 in the human genome to ~178 in the chicken genome. 45% of human copies are in highly conserved regions. Shows distant similarity to Leu tRNA. Tentatively classified as SINE element. Inverted from UCON3 original. Reference coords 1-78:tRNA-Leu- TTG, 137-264:Deu core, remainder must match an as yet unknown LINE. |
| Sequence |
GCCGGAGGGGATGGCTTAGTGGTCTAAGCATCAGGTTTGAAATACCTAGACTCCCTGGAACCACAGGTTCAAATCCCAGCAGGGTCGACTCAGCCCTTCATCCTTCCGAGGTAGATAAATTGAGTNCCACGCAGTTTACTGTGTGNGGGTCTTTCGGATGAGACCTTAAAAACCAAAGCCCTGTCTGCTCTGCGTGGACATTAAAGATCCCGTGGCGCTTTTCGTAAGAGTAGGGGTTTGCCCCGGTGCCCTTGGCCGAATTTCTGGAACCCGGCTGAAANCCCGGGGAAACCGAGAGCCTGGCTTATCCCTATAGGGTATTAGNCACCCTATAAAAGTTAAATTTATTTATTTATTT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| AmnSINE2 | NFKB1 | 232 | 244 | + | 1.31 | AGGGGTTTGCCCC |
| AmnSINE2 | IRF8 | 287 | 299 | + | 0.96 | GGAAACCGAGAGC |
| AmnSINE2 | IRF4 | 287 | 300 | + | -0.02 | GGAAACCGAGAGCC |
| AmnSINE2 | TRP2 | 162 | 182 | + | -1.61 | GACCTTAAAAACCAAAGCCCT |
| AmnSINE2 | TRP1 | 163 | 183 | + | -2.83 | ACCTTAAAAACCAAAGCCCTG |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
