Tigger19a

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000835
TE superfamily Tigger
TE class DNA
Species Theria_mammals
Length 323
Kimura value 34.37
Tau index 0.9914
Description TcMar-Tigger DNA transposon, Tigger19a subfamily (non-autonomous)
Comment Tigger19a is an older Tigger element, with "TA" TSDs. The termini are similar to autonomous SMAR15 Tigger element in the flatworm Schmidtea. There are about 2000 recognizable on average 35% substituted copies in the reconstructed laurasiatherian genome.
Sequence
CAGTCAACTCTCGATTATCCGCGTGTGGATTATCCACTTTGTGGATTATCCGCGGCGAATTTTAAATCCCAGGCCGGCTTCCCCTCGCCACCCAGCATGCTTCCGGGCCGCTTCCTCCCGCCATCAGTTGGTGTGTGCTCAGGGAATGCAAACTAATTTTAATATTAGCCTAAGCAAAACATAATTAGGAAGGTAAATCTGCTGCGAAAAAATCACATAATGCATTCCAAAGCCAAATANAAATGATTTTTGGATTATCCGCTGTTTTGGATTATCCGCGCCACTGCTCCCCTCCATTAGCGCGGATAATCGAGAGTTGACTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Tigger19a RPN4 86 92 - 13.80 GGTGGCG
Tigger19a Ets65A 99 106 - 13.77 CCGGAAGC
Tigger19a AT1G74840 30 38 - 13.59 AGTGGATAA
Tigger19a YY2 118 124 - 13.54 ATGGCGG
Tigger19a ZNF213 67 78 + 13.35 TCCCAGGCCGGC
Tigger19a ZHD9 182 196 - 13.34 TTACCTTCCTAATTA
Tigger19a UGA3 116 122 - 13.34 GGCGGGA
Tigger19a ELK4 98 106 + 13.27 TGCTTCCGG
Tigger19a E2F6 115 122 - 13.22 GGCGGGAG
Tigger19a ZNF257 82 91 - 13.16 GTGGCGAGGG


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).