Tigger19a
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000835 |
|---|---|
| TE superfamily | Tigger |
| TE order | DNA |
| Species | Theria_mammals |
| Length | 323 |
| Kimura value | 34.37 |
| Tau index | 0.9914 |
| Description | TcMar-Tigger DNA transposon, Tigger19a subfamily (non-autonomous) |
| Comment | Tigger19a is an older Tigger element, with "TA" TSDs. The termini are similar to autonomous SMAR15 Tigger element in the flatworm Schmidtea. There are about 2000 recognizable on average 35% substituted copies in the reconstructed laurasiatherian genome. |
| Sequence |
CAGTCAACTCTCGATTATCCGCGTGTGGATTATCCACTTTGTGGATTATCCGCGGCGAATTTTAAATCCCAGGCCGGCTTCCCCTCGCCACCCAGCATGCTTCCGGGCCGCTTCCTCCCGCCATCAGTTGGTGTGTGCTCAGGGAATGCAAACTAATTTTAATATTAGCCTAAGCAAAACATAATTAGGAAGGTAAATCTGCTGCGAAAAAATCACATAATGCATTCCAAAGCCAAATANAAATGATTTTTGGATTATCCGCTGTTTTGGATTATCCGCGCCACTGCTCCCCTCCATTAGCGCGGATAATCGAGAGTTGACTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Tigger19a | ZNF343 | 75 | 90 | + | 16.72 | CGGCTTCCCCTCGCCA |
| Tigger19a | ZNF343 | 108 | 123 | + | 14.91 | CCGCTTCCTCCCGCCA |
| Tigger19a | FOXH1 | 24 | 31 | - | 14.67 | AATCCACA |
| Tigger19a | FOXH1 | 40 | 47 | - | 14.67 | AATCCACA |
| Tigger19a | ZHD6 | 177 | 188 | + | 14.55 | AAACATAATTAG |
| Tigger19a | E2F8 | 115 | 123 | + | 14.31 | CTCCCGCCA |
| Tigger19a | nit-4 | 49 | 55 | + | 14.25 | TCCGCGG |
| Tigger19a | Ets21C | 99 | 106 | - | 14.07 | CCGGAAGC |
| Tigger19a | pdm3 | 181 | 188 | - | 13.86 | CTAATTAT |
| Tigger19a | ZNF263 | 113 | 119 | - | 13.83 | GGGAGGA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
