Tigger19a
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000835 |
|---|---|
| TE superfamily | Tigger |
| TE class | DNA |
| Species | Theria_mammals |
| Length | 323 |
| Kimura value | 34.37 |
| Tau index | 0.9914 |
| Description | TcMar-Tigger DNA transposon, Tigger19a subfamily (non-autonomous) |
| Comment | Tigger19a is an older Tigger element, with "TA" TSDs. The termini are similar to autonomous SMAR15 Tigger element in the flatworm Schmidtea. There are about 2000 recognizable on average 35% substituted copies in the reconstructed laurasiatherian genome. |
| Sequence |
CAGTCAACTCTCGATTATCCGCGTGTGGATTATCCACTTTGTGGATTATCCGCGGCGAATTTTAAATCCCAGGCCGGCTTCCCCTCGCCACCCAGCATGCTTCCGGGCCGCTTCCTCCCGCCATCAGTTGGTGTGTGCTCAGGGAATGCAAACTAATTTTAATATTAGCCTAAGCAAAACATAATTAGGAAGGTAAATCTGCTGCGAAAAAATCACATAATGCATTCCAAAGCCAAATANAAATGATTTTTGGATTATCCGCTGTTTTGGATTATCCGCGCCACTGCTCCCCTCCATTAGCGCGGATAATCGAGAGTTGACTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Tigger19a | Fer1 | 122 | 134 | - | 1.90 | ACACCAACTGATG |
| Tigger19a | E2F7 | 113 | 126 | + | -4.33 | TCCTCCCGCCATCA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
