THE1B

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000818
TE superfamily MaLR
TE class LTR
Species Haplorrhini
Length 364
Kimura value 9.49
Tau index 0.8640
Description THE1B Long Terminal Repeat for ERVL-MaLR endogenous retrovirus
Comment An LTR of the THE1B retrovirus-like MaLR element. Has 5 bp TSDs. This subfamily is an intermediate between THE1A and THE1C, and is 90% similar to both over the entire length.
Sequence
TGATATGGTTTGGCTGTGTCCCCACCCAAATCTCATCTTGAATTGTAGCTCCCATAATTCCCACGTGTCGTGGGAGGGACCCGGTGGGAGGTAATTGAATCATGGGGGCGGGTCTTTCCCGTGCTGTTCTCGTGATAGTGAATAAGTCTCACGAGATCTGATGGTTTTATAAAGGGGAGTTCCCCTGCACANGCTCTCTTGCCTGCCGCCATGTAAGACGTGNCTTTGCTCCTCCTTCGCCTTCCGCCATGATTGTGAGGCCTCCCCAGCCACGTGGAACTGTGAGTCCATTAAACCTCTTTCCTTTATAAATTACCCAGTCTCGGGTATGTCTTTATCAGCAGCGTGAAAACGGACTAATACA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
THE1B EmBP-1 61 68 - 14.49 ACACGTGG
THE1B CrebA 268 279 - 14.48 TTCCACGTGGCT
THE1B ABI5 62 69 - 14.41 GACACGTG
THE1B mxl-1 270 277 + 14.33 CCACGTGG
THE1B mxl-1 270 277 - 14.33 CCACGTGG
THE1B Mnt 270 276 + 14.31 CCACGTG
THE1B Mnt 271 277 - 14.31 CCACGTG
THE1B Mnt 61 67 + 14.31 CCACGTG
THE1B NFkb 175 185 - 14.29 GGGGAACTCCC
THE1B CrebA 268 279 + 14.11 AGCCACGTGGAA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).