MamSINE1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000996 |
|---|---|
| TE superfamily | RTE-end |
| TE class | SINE |
| Species | Mammalia |
| Length | 290 |
| Kimura value | 35.91 |
| Tau index | 0.9436 |
| Description | MamSINE1 (Mammalian Short INterspersed Element 1), tRNA-derived |
| Comment | MamSINE1 is a modest copy number SINE in mammals that captured a tRNA- Ile at the 5' end, and that remains remarkably similar over the full length of the tRNA. |
| Sequence |
GTCTGTGGCTGGTTAGCTCAGTTGGTTAGAGCACGGTGCTAATGAGGCCAAGGTCACGGGTTCGATCCCCGTGTGGGCCAGTTAGCTTTGCTCTGTTCCATGGCCACAGACTGCACCCCTAACCCCAGCCAGCCGTCTCGCAAATGCGTGCCGTTGGTCACAAGGGGGACCGGCAGAGAGTGTGGATGGNTCAGCGCAAATCCATCNCCACTACTGGAAAAACAACTCAAAGCACATGTCCTACTGATAGTGGGTCAGTAGCGTCATCTTCGTATACGAAGGACAGCACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MamSINE1 | Eip75B | 248 | 257 | + | 11.85 | TAGTGGGTCA |
| MamSINE1 | SIZF2 | 243 | 251 | + | 11.84 | ACTGATAGT |
| MamSINE1 | ZAT10 | 243 | 252 | - | 11.79 | CACTATCAGT |
| MamSINE1 | NR6A1 | 49 | 62 | + | 11.79 | CAAGGTCACGGGTT |
| MamSINE1 | AZF1 | 175 | 183 | - | 11.79 | ACACTCTCT |
| MamSINE1 | bowl | 210 | 217 | + | 11.74 | ACTACTGG |
| MamSINE1 | MGA::EVX1 | 34 | 44 | + | 11.56 | CGGTGCTAATG |
| MamSINE1 | odd-2 | 255 | 262 | - | 11.54 | GCTACTGA |
| MamSINE1 | sage | 229 | 239 | + | 11.52 | AAAGCACATGT |
| MamSINE1 | Plagl1 | 43 | 50 | + | 11.52 | TGAGGCCA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
