MamSINE1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000996 |
|---|---|
| TE superfamily | RTE-end |
| TE class | SINE |
| Species | Mammalia |
| Length | 290 |
| Kimura value | 35.91 |
| Tau index | 0.9436 |
| Description | MamSINE1 (Mammalian Short INterspersed Element 1), tRNA-derived |
| Comment | MamSINE1 is a modest copy number SINE in mammals that captured a tRNA- Ile at the 5' end, and that remains remarkably similar over the full length of the tRNA. |
| Sequence |
GTCTGTGGCTGGTTAGCTCAGTTGGTTAGAGCACGGTGCTAATGAGGCCAAGGTCACGGGTTCGATCCCCGTGTGGGCCAGTTAGCTTTGCTCTGTTCCATGGCCACAGACTGCACCCCTAACCCCAGCCAGCCGTCTCGCAAATGCGTGCCGTTGGTCACAAGGGGGACCGGCAGAGAGTGTGGATGGNTCAGCGCAAATCCATCNCCACTACTGGAAAAACAACTCAAAGCACATGTCCTACTGATAGTGGGTCAGTAGCGTCATCTTCGTATACGAAGGACAGCACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MamSINE1 | ZNF816 | 164 | 178 | + | 16.31 | GGGGGACCGGCAGAG |
| MamSINE1 | NR5A1 | 45 | 56 | + | 15.84 | AGGCCAAGGTCA |
| MamSINE1 | ESRRA | 48 | 56 | + | 15.37 | CCAAGGTCA |
| MamSINE1 | NR2F1 | 49 | 60 | + | 14.88 | CAAGGTCACGGG |
| MamSINE1 | Esrrg | 48 | 56 | + | 14.81 | CCAAGGTCA |
| MamSINE1 | ERR | 49 | 56 | + | 14.77 | CAAGGTCA |
| MamSINE1 | ESRRB | 48 | 57 | + | 14.41 | CCAAGGTCAC |
| MamSINE1 | Hr39 | 49 | 56 | + | 14.02 | CAAGGTCA |
| MamSINE1 | nhr-142 | 156 | 163 | + | 13.62 | GGTCACAA |
| MamSINE1 | REF6 | 91 | 99 | - | 13.51 | GGAACAGAG |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
