MamSINE1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000996 |
|---|---|
| TE superfamily | RTE-end |
| TE class | SINE |
| Species | Mammalia |
| Length | 290 |
| Kimura value | 35.91 |
| Tau index | 0.9436 |
| Description | MamSINE1 (Mammalian Short INterspersed Element 1), tRNA-derived |
| Comment | MamSINE1 is a modest copy number SINE in mammals that captured a tRNA- Ile at the 5' end, and that remains remarkably similar over the full length of the tRNA. |
| Sequence |
GTCTGTGGCTGGTTAGCTCAGTTGGTTAGAGCACGGTGCTAATGAGGCCAAGGTCACGGGTTCGATCCCCGTGTGGGCCAGTTAGCTTTGCTCTGTTCCATGGCCACAGACTGCACCCCTAACCCCAGCCAGCCGTCTCGCAAATGCGTGCCGTTGGTCACAAGGGGGACCGGCAGAGAGTGTGGATGGNTCAGCGCAAATCCATCNCCACTACTGGAAAAACAACTCAAAGCACATGTCCTACTGATAGTGGGTCAGTAGCGTCATCTTCGTATACGAAGGACAGCACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MamSINE1 | TB1 | 163 | 171 | - | 12.52 | GGTCCCCCT |
| MamSINE1 | POU6F1 | 40 | 46 | + | 12.50 | TAATGAG |
| MamSINE1 | POU6F2 | 40 | 48 | - | 12.36 | GCCTCATTA |
| MamSINE1 | zen | 39 | 45 | + | 12.23 | CTAATGA |
| MamSINE1 | ZNF692 | 73 | 80 | - | 12.19 | TGGCCCAC |
| MamSINE1 | HSF1 | 95 | 101 | - | 12.13 | ATGGAAC |
| MamSINE1 | fkh-9 | 218 | 225 | + | 12.13 | AAAAACAA |
| MamSINE1 | PAX5 | 52 | 59 | - | 12.09 | CCGTGACC |
| MamSINE1 | NR6A1 | 43 | 56 | + | 11.90 | TGAGGCCAAGGTCA |
| MamSINE1 | EDS1 | 216 | 222 | + | 11.88 | GGAAAAA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
