MamSINE1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000996 |
|---|---|
| TE superfamily | RTE-end |
| TE class | SINE |
| Species | Mammalia |
| Length | 290 |
| Kimura value | 35.91 |
| Tau index | 0.9436 |
| Description | MamSINE1 (Mammalian Short INterspersed Element 1), tRNA-derived |
| Comment | MamSINE1 is a modest copy number SINE in mammals that captured a tRNA- Ile at the 5' end, and that remains remarkably similar over the full length of the tRNA. |
| Sequence |
GTCTGTGGCTGGTTAGCTCAGTTGGTTAGAGCACGGTGCTAATGAGGCCAAGGTCACGGGTTCGATCCCCGTGTGGGCCAGTTAGCTTTGCTCTGTTCCATGGCCACAGACTGCACCCCTAACCCCAGCCAGCCGTCTCGCAAATGCGTGCCGTTGGTCACAAGGGGGACCGGCAGAGAGTGTGGATGGNTCAGCGCAAATCCATCNCCACTACTGGAAAAACAACTCAAAGCACATGTCCTACTGATAGTGGGTCAGTAGCGTCATCTTCGTATACGAAGGACAGCACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MamSINE1 | sex-1 | 50 | 57 | + | 13.51 | AAGGTCAC |
| MamSINE1 | NR2F2 | 50 | 56 | + | 13.14 | AAGGTCA |
| MamSINE1 | nhr-25 | 49 | 56 | + | 13.07 | CAAGGTCA |
| MamSINE1 | RPH1 | 116 | 122 | + | 13.07 | CCCCTAA |
| MamSINE1 | ZNF524 | 58 | 66 | - | 13.03 | ATCGAACCC |
| MamSINE1 | ZNF189 | 91 | 99 | + | 13.02 | CTCTGTTCC |
| MamSINE1 | Nr5A2 | 48 | 56 | - | 12.96 | TGACCTTGG |
| MamSINE1 | Ppara | 50 | 56 | + | 12.88 | AAGGTCA |
| MamSINE1 | INSM1 | 120 | 131 | - | 12.88 | TGGCTGGGGTTA |
| MamSINE1 | svp | 50 | 56 | + | 12.82 | AAGGTCA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
