MamSINE1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000996 |
|---|---|
| TE superfamily | RTE-end |
| TE class | SINE |
| Species | Mammalia |
| Length | 290 |
| Kimura value | 35.91 |
| Tau index | 0.9436 |
| Description | MamSINE1 (Mammalian Short INterspersed Element 1), tRNA-derived |
| Comment | MamSINE1 is a modest copy number SINE in mammals that captured a tRNA- Ile at the 5' end, and that remains remarkably similar over the full length of the tRNA. |
| Sequence |
GTCTGTGGCTGGTTAGCTCAGTTGGTTAGAGCACGGTGCTAATGAGGCCAAGGTCACGGGTTCGATCCCCGTGTGGGCCAGTTAGCTTTGCTCTGTTCCATGGCCACAGACTGCACCCCTAACCCCAGCCAGCCGTCTCGCAAATGCGTGCCGTTGGTCACAAGGGGGACCGGCAGAGAGTGTGGATGGNTCAGCGCAAATCCATCNCCACTACTGGAAAAACAACTCAAAGCACATGTCCTACTGATAGTGGGTCAGTAGCGTCATCTTCGTATACGAAGGACAGCACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MamSINE1 | ZNF684 | 108 | 121 | + | 6.43 | AGACTGCACCCCTA |
| MamSINE1 | Rarg | 50 | 64 | + | 3.40 | AAGGTCACGGGTTCG |
| MamSINE1 | Rarb | 49 | 64 | + | 0.93 | CAAGGTCACGGGTTCG |
| MamSINE1 | Nr2F6 | 50 | 64 | + | -4.27 | AAGGTCACGGGTTCG |
| MamSINE1 | RARA | 50 | 67 | + | -10.82 | AAGGTCACGGGTTCGATC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
