MLT1H2

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0001131
TE superfamily MaLR
TE order LTR
Species Eutheria
Length 489
Kimura value 25.76
Tau index 0.9179
Description MLT1H2 Long Terminal Repeat for ERVL-MaLR retrotransposon
Comment Note that a full-length ERV-MaLR (Mammalian apparent LTR retrotransposon) element is derived from an ERV (Endogenous Retrovirus), but only contains the Gag gene (that is, no Pol or Env).
Sequence
TGTGGTAGACTGTTACATTGGTGGCCCCCAATGAACCACGCCTCCCGGTATTCACGCCCTTGTGTAGTCCCCTCCCACATTGACTCTGGGCTTGGCCATGTGACTTGCTTTGGCCAATGGGACATTAGCAAACGTGATGCAAGCAGAGGCTTGANAAGCGCTTGCGCATTGGGGCTTGTCCTCTTGGAACGCTCCCTCTTGGAANCCAGCTGCCATGCTGTGAAGAAGCCCAGGCTAGNCTGCTGGANGATGAGAGGCCACGTGGAGAGAGGCCCTGGAGGATGAGAGGCCATCTTGGACGTTCCAGCCCCAGCCGAGCTCCCAGCTGAATGCAGCCACATGAGTGACCCCAGCTANACCACGTGGAGCAGAAGAACCGCCCAGCTGAGCCCAGCCAACCCACAGAATCGTGAGAAATAATAAATCGTTGTTGTTTTAAGCCACTAAGTTTTGGGGTGGTTTGTTACGCAGCAATAGATAACTGAAACA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
MLT1H2 mxl-3 258 265 - 14.59 CCACGTGG
MLT1H2 mxl-3 359 366 + 14.59 CCACGTGG
MLT1H2 mxl-3 359 366 - 14.59 CCACGTGG
MLT1H2 phol 288 297 + 14.54 GGCCATCTTG
MLT1H2 ci 393 403 + 14.51 AGCCAACCCAC
MLT1H2 BAS1 80 91 - 14.49 GCCCAGAGTCAA
MLT1H2 mxl-1 258 265 + 14.33 CCACGTGG
MLT1H2 mxl-1 258 265 - 14.33 CCACGTGG
MLT1H2 mxl-1 359 366 + 14.33 CCACGTGG
MLT1H2 mxl-1 359 366 - 14.33 CCACGTGG


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).