MIRc
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0000976 |
---|---|
TE superfamily | L2-end |
TE class | SINE |
Species | Mammalia |
Length | 268 |
Kimura value | 35.35 |
Tau index | 0.9012 |
Description | MIRc (Mammalian-wide Interspersed Repeat - variant c) |
Comment | MIRc is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region (shared with other MIRs), and a 3' terminal ~55bp related to an L2 LINE. |
Sequence |
CGAGGCAGTGTGGTGCAGTGGAAAGAGCACTGGACTTGGAGTCAGGAAGACCTGGGTTCGAGTCCCGGCTCTGCCACTTACTAGCTGTGTGACCTTGGGCAAGTCACTTAACCTCTCTGAGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATAATACCTGCCCTGCCTACCTCACAGGGTTGTTGTGAGGATCAAATGAGATAATGTATGTGAAAGCGCTTTGTAAACTGTAAAGTGCTATACAAATGTAAGGNGTTATTATTATT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
MIRc | pita | 55 | 72 | - | 17.76 | AGAGCCGGGACTCGAACC |
MIRc | ZNF524 | 54 | 62 | - | 16.05 | CTCGAACCC |
MIRc | ESRRA | 90 | 98 | - | 15.37 | CCAAGGTCA |
MIRc | Esrrg | 90 | 98 | - | 14.81 | CCAAGGTCA |
MIRc | THAP1 | 161 | 168 | - | 14.80 | GCAGGGCA |
MIRc | ERR | 90 | 97 | - | 14.77 | CAAGGTCA |
MIRc | ZNF768 | 111 | 119 | + | 14.62 | ACCTCTCTG |
MIRc | ESRRB | 89 | 98 | - | 14.41 | CCAAGGTCAC |
MIRc | Hr39 | 90 | 97 | - | 14.02 | CAAGGTCA |
MIRc | hr3 | 87 | 94 | - | 13.92 | GGTCACAC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.