MIR3
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000974 |
|---|---|
| TE superfamily | L2-end |
| TE order | SINE |
| Species | Mammalia |
| Length | 208 |
| Kimura value | 34.83 |
| Tau index | 0.7446 |
| Description | MIR3 (Mammalian-wide Interspersed Repeat 3) |
| Comment | MIR3 is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region (shared with other MIRs), and a 3' terminal ~55bp related to an L3 LINE. |
| Sequence |
CTGGCAGAGTGGCTGAGCAGAGAGAGCACGGACTGGGAGTCAGGAGACCTGGGTTCTAGTCCCGGCTCTGCCACTAACTNGCTGTGTGACCTTGGGCAAGTCACTTCACCTCTCTGGGCCTCAGTTTCCTCATCTGTAAAATGAGGGGGTTGGACTAGATGATCTCTAAGGTCCCTTCCAGCTCTGACATTCTATGATTCTATGATTC
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MIR3 | ZNF528 | 91 | 107 | + | 8.04 | CTTGGGCAAGTCACTTC |
| MIR3 | Rarg | 106 | 122 | - | -3.49 | GAGGCCCAGAGAGGTGA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
