MIR3
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000974 |
|---|---|
| TE superfamily | L2-end |
| TE order | SINE |
| Species | Mammalia |
| Length | 208 |
| Kimura value | 34.83 |
| Tau index | 0.7446 |
| Description | MIR3 (Mammalian-wide Interspersed Repeat 3) |
| Comment | MIR3 is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region (shared with other MIRs), and a 3' terminal ~55bp related to an L3 LINE. |
| Sequence |
CTGGCAGAGTGGCTGAGCAGAGAGAGCACGGACTGGGAGTCAGGAGACCTGGGTTCTAGTCCCGGCTCTGCCACTAACTNGCTGTGTGACCTTGGGCAAGTCACTTCACCTCTCTGGGCCTCAGTTTCCTCATCTGTAAAATGAGGGGGTTGGACTAGATGATCTCTAAGGTCCCTTCCAGCTCTGACATTCTATGATTCTATGATTC
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MIR3 | PI | 124 | 137 | - | 11.67 | ACAGATGAGGAAAC |
| MIR3 | ASR1 | 113 | 121 | - | 11.43 | AGGCCCAGA |
| MIR3 | VIP1 | 176 | 185 | + | 11.38 | TTCCAGCTCT |
| MIR3 | M1BP | 82 | 92 | - | 11.37 | AGGTCACACAG |
| MIR3 | AP1 | 125 | 137 | - | 11.35 | ACAGATGAGGAAA |
| MIR3 | Trl | 20 | 28 | + | 11.20 | GAGAGAGCA |
| MIR3 | ZAT10 | 66 | 75 | + | 11.18 | CTCTGCCACT |
| MIR3 | SPIB | 101 | 113 | + | 10.96 | TCACTTCACCTCT |
| MIR3 | ftz-f1 | 88 | 95 | + | 10.94 | GACCTTGG |
| MIR3 | PAX5 | 84 | 91 | + | 10.91 | GTGTGACC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
