MIR3
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000974 |
|---|---|
| TE superfamily | L2-end |
| TE class | SINE |
| Species | Mammalia |
| Length | 208 |
| Kimura value | 34.83 |
| Tau index | 0.7446 |
| Description | MIR3 (Mammalian-wide Interspersed Repeat 3) |
| Comment | MIR3 is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region (shared with other MIRs), and a 3' terminal ~55bp related to an L3 LINE. |
| Sequence |
CTGGCAGAGTGGCTGAGCAGAGAGAGCACGGACTGGGAGTCAGGAGACCTGGGTTCTAGTCCCGGCTCTGCCACTAACTNGCTGTGTGACCTTGGGCAAGTCACTTCACCTCTCTGGGCCTCAGTTTCCTCATCTGTAAAATGAGGGGGTTGGACTAGATGATCTCTAAGGTCCCTTCCAGCTCTGACATTCTATGATTCTATGATTC
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MIR3 | svp | 87 | 93 | - | 12.82 | AAGGTCA |
| MIR3 | ZNF574 | 106 | 119 | - | 12.75 | GCCCAGAGAGGTGA |
| MIR3 | ZNF416 | 111 | 120 | + | 12.40 | TCTCTGGGCC |
| MIR3 | NRG1 | 170 | 177 | - | 12.30 | AAGGGACC |
| MIR3 | ARG81 | 36 | 42 | - | 12.30 | TGACTCC |
| MIR3 | AGL15 | 125 | 140 | + | 12.20 | TTTCCTCATCTGTAAA |
| MIR3 | ss | 83 | 90 | + | 12.10 | TGTGTGAC |
| MIR3 | ZNF692 | 114 | 121 | - | 12.00 | AGGCCCAG |
| MIR3 | AG | 125 | 140 | + | 11.79 | TTTCCTCATCTGTAAA |
| MIR3 | nhr-142 | 84 | 91 | - | 11.70 | GGTCACAC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
