MIR3
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000974 |
|---|---|
| TE superfamily | L2-end |
| TE order | SINE |
| Species | Mammalia |
| Length | 208 |
| Kimura value | 34.83 |
| Tau index | 0.7446 |
| Description | MIR3 (Mammalian-wide Interspersed Repeat 3) |
| Comment | MIR3 is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region (shared with other MIRs), and a 3' terminal ~55bp related to an L3 LINE. |
| Sequence |
CTGGCAGAGTGGCTGAGCAGAGAGAGCACGGACTGGGAGTCAGGAGACCTGGGTTCTAGTCCCGGCTCTGCCACTAACTNGCTGTGTGACCTTGGGCAAGTCACTTCACCTCTCTGGGCCTCAGTTTCCTCATCTGTAAAATGAGGGGGTTGGACTAGATGATCTCTAAGGTCCCTTCCAGCTCTGACATTCTATGATTCTATGATTC
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MIR3 | ZNF768 | 18 | 26 | - | 13.35 | CTCTCTCTG |
| MIR3 | GRF6 | 183 | 189 | + | 13.30 | TCTGACA |
| MIR3 | NR2F2 | 87 | 93 | - | 13.14 | AAGGTCA |
| MIR3 | Trl | 18 | 26 | + | 13.13 | CAGAGAGAG |
| MIR3 | AGL16 | 125 | 139 | + | 13.12 | TTTCCTCATCTGTAA |
| MIR3 | nhr-25 | 87 | 94 | - | 13.07 | CAAGGTCA |
| MIR3 | GRF9 | 183 | 189 | - | 13.03 | TGTCAGA |
| MIR3 | Nr5A2 | 87 | 95 | + | 12.96 | TGACCTTGG |
| MIR3 | ZNF331 | 63 | 72 | - | 12.91 | GGCAGAGCCG |
| MIR3 | Ppara | 87 | 93 | - | 12.88 | AAGGTCA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
