MIR3

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000974
TE superfamily L2-end
TE order SINE
Species Mammalia
Length 208
Kimura value 34.83
Tau index 0.7446
Description MIR3 (Mammalian-wide Interspersed Repeat 3)
Comment MIR3 is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region (shared with other MIRs), and a 3' terminal ~55bp related to an L3 LINE.
Sequence
CTGGCAGAGTGGCTGAGCAGAGAGAGCACGGACTGGGAGTCAGGAGACCTGGGTTCTAGTCCCGGCTCTGCCACTAACTNGCTGTGTGACCTTGGGCAAGTCACTTCACCTCTCTGGGCCTCAGTTTCCTCATCTGTAAAATGAGGGGGTTGGACTAGATGATCTCTAAGGTCCCTTCCAGCTCTGACATTCTATGATTCTATGATTC



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
MIR3 ZNF768 18 26 - 13.35 CTCTCTCTG
MIR3 GRF6 183 189 + 13.30 TCTGACA
MIR3 NR2F2 87 93 - 13.14 AAGGTCA
MIR3 Trl 18 26 + 13.13 CAGAGAGAG
MIR3 AGL16 125 139 + 13.12 TTTCCTCATCTGTAA
MIR3 nhr-25 87 94 - 13.07 CAAGGTCA
MIR3 GRF9 183 189 - 13.03 TGTCAGA
MIR3 Nr5A2 87 95 + 12.96 TGACCTTGG
MIR3 ZNF331 63 72 - 12.91 GGCAGAGCCG
MIR3 Ppara 87 93 - 12.88 AAGGTCA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).