MIR

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000001
TE superfamily L2-end
TE order SINE
Species Mammalia
Length 262
Kimura value 31.97
Tau index 0.9376
Description MIR (Mammalian-wide Interspersed Repeat)
Comment MIR is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region, and a 3' terminal ~55bp related to an L2 LINE.
Sequence
ACAGTATAGCATAGTGGTTAAGAGCACGGGCTCTGGAGCCAGACTGCCTGGGTTCGAATCCCGGCTCTGCCACTTACTAGCTGTGTGACCTTGGGCAAGTTACTTAACCTCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATAATAGTACCTACCTCATAGGGTTGTTGTGAGGATTAAATGAGTTAATACATGTAAAGCGCTTAGAACAGTGCCTGGCACATAGTAAGCGCTCAATAAATGTTAGCTATTATT



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
MIR Ptx1 181 187 - 12.99 TTAATCC
MIR Nr5A2 86 94 + 12.96 TGACCTTGG
MIR ZNF331 62 71 - 12.91 GGCAGAGCCG
MIR ZNF784 157 164 + 12.89 ACCTACCT
MIR MYB61 156 163 + 12.89 TACCTACC
MIR Ppara 86 92 - 12.88 AAGGTCA
MIR svp 86 92 - 12.82 AAGGTCA
MIR SPL5B 152 158 + 12.81 ATAGTAC
MIR Nkx3-1 70 76 + 12.79 CCACTTA
MIR Hoxd13 242 248 + 12.73 CAATAAA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).