MIR
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0000001 |
---|---|
TE superfamily | L2-end |
TE class | SINE |
Species | Mammalia |
Length | 262 |
Kimura value | 31.97 |
Tau index | 0.9376 |
Description | MIR (Mammalian-wide Interspersed Repeat) |
Comment | MIR is a pan-mammalian SINE with a 5' end derived from a tRNA, a central deeply-conserved CORE region, and a 3' terminal ~55bp related to an L2 LINE. |
Sequence |
ACAGTATAGCATAGTGGTTAAGAGCACGGGCTCTGGAGCCAGACTGCCTGGGTTCGAATCCCGGCTCTGCCACTTACTAGCTGTGTGACCTTGGGCAAGTTACTTAACCTCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATAATAGTACCTACCTCATAGGGTTGTTGTGAGGATTAAATGAGTTAATACATGTAAAGCGCTTAGAACAGTGCCTGGCACATAGTAAGCGCTCAATAAATGTTAGCTATTATT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
MIR | RAMOSA1 | 108 | 121 | - | 6.13 | GAGGCACAGAGAGG |
MIR | MEF2D | 145 | 156 | + | 5.87 | GATAATAATAGT |
MIR | BCL6B | 193 | 209 | - | -16.63 | CGCTTTACATGTATTAA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.