MER110A

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000706
TE superfamily ERV1
TE class LTR
Species Eutheria
Length 468
Kimura value 25.84
Tau index 0.0000
Description MER110A Long Terminal Repeat for ERV1 endogenous retrovirus
Comment Similar to MER110 in the 3' region, and more modestly, to MER90a across that same region. Note that MER stands for MEdium Reiteration frequency interspersed repeat. As such, MERs as a group are a grab bag of DNA transposons and retrotransposons.
Sequence
TGAGAACCGAAACCATCTACCACCCACACAGCTTACTGNCTGTCTACATTAACATGACTTTACTATTCCACTGTCTTCATCAACATGACTTTACTATTCCAGGAAACTCTTGCCCAGGAAGATAAAAGTTGCAAATAACTTTATTGTTCATTNCAGGAACTTCCCGAAAGACCCATCAACTCTTCAATAGAAAGCATCAAACGACAGTTTATCCCCAAGACTCTTTGAANCCCTCGCCTCAAAATCCTCGCCTTGCTGTGTCTNCGTCCACCAATCCTAAACTATTATATCATGATCCTTACCCAATCCTAATCAAGCCCCCGCATTGAAAGACCCGCCTTAAACCAGACTCCAAAATCTCAATAAATATCCCGACTTTGCCCTCCCTCCTCTGAGACGCTACTAAGACTCTGTAAGGTGGTGCTCTCCCTTACCGCGGTAAGCAATAAACTCAGCTTTGTCTTATCA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
MER110A ZBED2 8 14 + 13.20 CGAAACC
MER110A srp 461 468 - 12.97 TGATAAGA
MER110A F10B5.3 95 105 + 12.96 TATTCCAGGAA
MER110A THAP1 379 386 - 12.95 GGAGGGCA
MER110A STAT3 97 105 + 12.84 TTCCAGGAA
MER110A STAT1 97 105 - 12.84 TTCCTGGAA
MER110A Sox6 455 464 + 12.80 GCTTTGTCTT
MER110A Stat5a::Stat5b 97 105 - 12.78 TTCCTGGAA
MER110A Cdx 443 450 - 12.76 TTTATTGC
MER110A Hoxd13 140 146 - 12.73 CAATAAA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).