MER110A
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000706 |
|---|---|
| TE superfamily | ERV1 |
| TE class | LTR |
| Species | Eutheria |
| Length | 468 |
| Kimura value | 25.84 |
| Tau index | 0.0000 |
| Description | MER110A Long Terminal Repeat for ERV1 endogenous retrovirus |
| Comment | Similar to MER110 in the 3' region, and more modestly, to MER90a across that same region. Note that MER stands for MEdium Reiteration frequency interspersed repeat. As such, MERs as a group are a grab bag of DNA transposons and retrotransposons. |
| Sequence |
TGAGAACCGAAACCATCTACCACCCACACAGCTTACTGNCTGTCTACATTAACATGACTTTACTATTCCACTGTCTTCATCAACATGACTTTACTATTCCAGGAAACTCTTGCCCAGGAAGATAAAAGTTGCAAATAACTTTATTGTTCATTNCAGGAACTTCCCGAAAGACCCATCAACTCTTCAATAGAAAGCATCAAACGACAGTTTATCCCCAAGACTCTTTGAANCCCTCGCCTCAAAATCCTCGCCTTGCTGTGTCTNCGTCCACCAATCCTAAACTATTATATCATGATCCTTACCCAATCCTAATCAAGCCCCCGCATTGAAAGACCCGCCTTAAACCAGACTCCAAAATCTCAATAAATATCCCGACTTTGCCCTCCCTCCTCTGAGACGCTACTAAGACTCTGTAAGGTGGTGCTCTCCCTTACCGCGGTAAGCAATAAACTCAGCTTTGTCTTATCA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| MER110A | klu | 20 | 30 | + | 18.79 | CCACCCACACA |
| MER110A | ZNF257 | 231 | 240 | - | 16.80 | GAGGCGAGGG |
| MER110A | ATMYB31 | 14 | 28 | + | 16.36 | CATCTACCACCCACA |
| MER110A | MYB31 | 14 | 28 | + | 16.36 | CATCTACCACCCACA |
| MER110A | Stat4 | 97 | 106 | + | 15.84 | TTCCAGGAAA |
| MER110A | STAT1 | 97 | 105 | + | 15.62 | TTCCAGGAA |
| MER110A | STAT1::STAT2 | 2 | 14 | - | 14.73 | GGTTTCGGTTCTC |
| MER110A | elt-3 | 461 | 468 | + | 14.52 | TCTTATCA |
| MER110A | Stat5a | 97 | 105 | + | 14.42 | TTCCAGGAA |
| MER110A | IRF6 | 6 | 14 | + | 14.24 | ACCGAAACC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
