MER110A
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0000706 |
---|---|
TE superfamily | ERV1 |
TE class | LTR |
Species | Eutheria |
Length | 468 |
Kimura value | 25.84 |
Tau index | 0.0000 |
Description | MER110A Long Terminal Repeat for ERV1 endogenous retrovirus |
Comment | Similar to MER110 in the 3' region, and more modestly, to MER90a across that same region. Note that MER stands for MEdium Reiteration frequency interspersed repeat. As such, MERs as a group are a grab bag of DNA transposons and retrotransposons. |
Sequence |
TGAGAACCGAAACCATCTACCACCCACACAGCTTACTGNCTGTCTACATTAACATGACTTTACTATTCCACTGTCTTCATCAACATGACTTTACTATTCCAGGAAACTCTTGCCCAGGAAGATAAAAGTTGCAAATAACTTTATTGTTCATTNCAGGAACTTCCCGAAAGACCCATCAACTCTTCAATAGAAAGCATCAAACGACAGTTTATCCCCAAGACTCTTTGAANCCCTCGCCTCAAAATCCTCGCCTTGCTGTGTCTNCGTCCACCAATCCTAAACTATTATATCATGATCCTTACCCAATCCTAATCAAGCCCCCGCATTGAAAGACCCGCCTTAAACCAGACTCCAAAATCTCAATAAATATCCCGACTTTGCCCTCCCTCCTCTGAGACGCTACTAAGACTCTGTAAGGTGGTGCTCTCCCTTACCGCGGTAAGCAATAAACTCAGCTTTGTCTTATCA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
MER110A | elt-2 | 461 | 468 | + | 14.16 | TCTTATCA |
MER110A | CDX2 | 443 | 450 | + | 14.13 | GCAATAAA |
MER110A | Mecom | 458 | 468 | - | 14.12 | TGATAAGACAA |
MER110A | Stat92E | 95 | 106 | + | 14.04 | TATTCCAGGAAA |
MER110A | sta-1 | 97 | 105 | + | 14.00 | TTCCAGGAA |
MER110A | Stat92E | 96 | 107 | - | 13.96 | GTTTCCTGGAAT |
MER110A | Stat5a::Stat5b | 97 | 105 | + | 13.86 | TTCCAGGAA |
MER110A | STAT3 | 97 | 105 | - | 13.65 | TTCCTGGAA |
MER110A | gcm | 320 | 326 | + | 13.38 | CCCGCAT |
MER110A | CDX4 | 443 | 451 | + | 13.34 | GCAATAAAC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.