LTR7Y

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000589
TE superfamily ERV1
TE order LTR
Species Hominidae
Length 464
Kimura value 5.96
Tau index 0.9508
Description Long terminal repeat of an HERVH endogenous retrovirus
Comment LTR of an HERVH element active 7-18 MYA, mostly in the common ancestor of gorilla, human and chimp. Updated from 2005 entry. Two copies are in the human hg38 genome are precisely absent from the chimpanzee genome: a solo LTR at chr11:49842787-49843262 with surprisingly many mutations, and a copy with a partial internal sequence at chr9:86586832-86589058. A 21-bp sequence starting at pos 174 is present in 1 or 2 tandem copies.
Sequence
TGTCAGGCCTCTGAGCCCAGGCCAGGCCATCGCATCCCCTGTGACTTGCACGTATACATCCAGATGGCCTGAAGTAACTGAAGATCCACAAAAGAAGTAAAAACAGCCTTAACTGATGACATTCCACCATTGTGATTTGTTCCTGCCCCACCCTAACTGATCAATGTACTTTGTAATCTCCCCCACCCTTGCTTTGTAGTCTCCCCCACCCTTAAGAAGGTTCTTTGTAATTCTCCCCACCCTTGAGAATGTACTTTGTGAGATCCACCCCTGCCCACCAGAGAACAACCCCCTTTGACTGTAATTTTCCATTACCTTCCCAAATCCTATAAAACGGCCCCACCCCTATCTCCCTTCGCTGACTCTCTTTTCGGACTCAGCCCGCCTGCACCCAGGTGAAATAAACAGCCATGTTGCTCACACAAAGCCTGTTTGGTGGTCTCTTCACACGGACGCGCATGAAA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
LTR7Y KLF1 146 153 - 14.64 GGGTGGGG
LTR7Y KLF1 181 188 - 14.64 GGGTGGGG
LTR7Y KLF1 204 211 - 14.64 GGGTGGGG
LTR7Y KLF1 235 242 - 14.64 GGGTGGGG
LTR7Y KLF1 338 345 - 14.64 GGGTGGGG
LTR7Y TEAD4 119 126 + 14.45 ACATTCCA
LTR7Y ZFP42 404 416 - 14.38 CAACATGGCTGTT
LTR7Y Glyma19g26560.1 336 343 + 14.23 GGCCCCAC
LTR7Y GLYMA19G26560 336 343 + 14.23 GGCCCCAC
LTR7Y Nfat5 305 312 - 14.18 ATGGAAAA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).