LTR7Y
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0000589 |
---|---|
TE superfamily | ERV1 |
TE class | LTR |
Species | Hominidae |
Length | 464 |
Kimura value | 5.96 |
Tau index | 0.9508 |
Description | Long terminal repeat of an HERVH endogenous retrovirus |
Comment | LTR of an HERVH element active 7-18 MYA, mostly in the common ancestor of gorilla, human and chimp. Updated from 2005 entry. Two copies are in the human hg38 genome are precisely absent from the chimpanzee genome: a solo LTR at chr11:49842787-49843262 with surprisingly many mutations, and a copy with a partial internal sequence at chr9:86586832-86589058. A 21-bp sequence starting at pos 174 is present in 1 or 2 tandem copies. |
Sequence |
TGTCAGGCCTCTGAGCCCAGGCCAGGCCATCGCATCCCCTGTGACTTGCACGTATACATCCAGATGGCCTGAAGTAACTGAAGATCCACAAAAGAAGTAAAAACAGCCTTAACTGATGACATTCCACCATTGTGATTTGTTCCTGCCCCACCCTAACTGATCAATGTACTTTGTAATCTCCCCCACCCTTGCTTTGTAGTCTCCCCCACCCTTAAGAAGGTTCTTTGTAATTCTCCCCACCCTTGAGAATGTACTTTGTGAGATCCACCCCTGCCCACCAGAGAACAACCCCCTTTGACTGTAATTTTCCATTACCTTCCCAAATCCTATAAAACGGCCCCACCCCTATCTCCCTTCGCTGACTCTCTTTTCGGACTCAGCCCGCCTGCACCCAGGTGAAATAAACAGCCATGTTGCTCACACAAAGCCTGTTTGGTGGTCTCTTCACACGGACGCGCATGAAA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
LTR7Y | KLF4 | 338 | 345 | + | 15.48 | CCCCACCC |
LTR7Y | ARALYDRAFT_495258 | 336 | 343 | + | 15.43 | GGCCCCAC |
LTR7Y | ARALYDRAFT_484486 | 336 | 343 | + | 15.43 | GGCCCCAC |
LTR7Y | KLF10 | 338 | 346 | - | 15.20 | GGGGTGGGG |
LTR7Y | PI | 88 | 101 | + | 15.12 | ACAAAAGAAGTAAA |
LTR7Y | ZKSCAN3 | 16 | 29 | + | 14.99 | CCCAGGCCAGGCCA |
LTR7Y | Dmrt1 | 167 | 175 | - | 14.85 | TACAAAGTA |
LTR7Y | PATZ1 | 337 | 347 | - | 14.82 | AGGGGTGGGGC |
LTR7Y | MYB107 | 431 | 438 | - | 14.64 | CACCAAAC |
LTR7Y | ARALYDRAFT_493022 | 336 | 343 | + | 14.64 | GGCCCCAC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.