LTR12F
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000405 |
|---|---|
| TE superfamily | ERV1 |
| TE order | LTR |
| Species | Catarrhini |
| Length | 519 |
| Kimura value | 6.71 |
| Tau index | 0.9044 |
| Description | Long terminal repeat of class I endogenous retrovirus HERV9 |
| Comment | Positions 73-207 of the consensus contains 5 copies of a 23-bp-period tandem repeat interrupted by a 15 bp sequence. The number of units at any locus is variable. Matches limited to pos. ~334 to 411 represent retroposed copies of the region of the LTR between the transcription initiation and termination signals (named R as it Repeats at the ends of the transcript). They are followed by a poly A tail and were likely introduced by the LINE1 machinery. They could be the result of R-R recombination of a LINE1-retroposed full transcripts, though no full processed psuedogenes of HERV9 with LTR12F LTRs survived. Slight target site duplication preference for MTAK. |
| Sequence |
TGAGAGGTGAAGCCAGCTGGACTTCCTGGGTCGAGTGGGGACTTGGAGAACTTTTCTGTCTTACAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAAACGCACCAATCAGCGCTCTGTAGCTAGCAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCAGGATTCTAAAAGTAGCCAATCGCGGGGAGGATTGAAAAAAGGGCACTCTGATAGGACAGAAACGGAACATGGGAGGGGACAAATAAGGGAATAAAAGCTGGCCACCCCAGCCAGCAGCGGCAACCCGCTCGGGTCCCCTTCCACGCTGTGGAAGCTTTGTTCTTTCGCTCTTCACAATAAACCTTGCTGCCGCTCACTCTTTGGGTCCGTGCCATCTTTAAGAGCTGTAACACTCACCGCGAAGGTCCGCGGCTTCATTCTTGAAGTCAGCGAGACCACGAACCCACCGGNAGGAACCAACTCCGGACACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| LTR12F | ZNF454 | 476 | 492 | - | 13.63 | GGTTCGTGGTCTCGCTG |
| LTR12F | ELF1 | 20 | 28 | - | 13.54 | CAGGAAGTC |
| LTR12F | KLF5 | 278 | 287 | - | 13.47 | TCCCCTCCCA |
| LTR12F | AP1 | 287 | 299 | + | 13.46 | ACAAATAAGGGAA |
| LTR12F | BZIP18 | 11 | 20 | + | 13.44 | AGCCAGCTGG |
| LTR12F | EHF | 20 | 28 | + | 13.23 | GACTTCCTG |
| LTR12F | KLF1 | 279 | 286 | + | 13.17 | GGGAGGGG |
| LTR12F | PK27109.1 | 12 | 19 | + | 13.03 | GCCAGCTG |
| LTR12F | ELF3 | 20 | 28 | + | 13.00 | GACTTCCTG |
| LTR12F | HAP3 | 222 | 230 | - | 12.92 | CGATTGGCT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.