LTR12F
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000405 |
|---|---|
| TE superfamily | ERV1 |
| TE order | LTR |
| Species | Catarrhini |
| Length | 519 |
| Kimura value | 6.71 |
| Tau index | 0.9044 |
| Description | Long terminal repeat of class I endogenous retrovirus HERV9 |
| Comment | Positions 73-207 of the consensus contains 5 copies of a 23-bp-period tandem repeat interrupted by a 15 bp sequence. The number of units at any locus is variable. Matches limited to pos. ~334 to 411 represent retroposed copies of the region of the LTR between the transcription initiation and termination signals (named R as it Repeats at the ends of the transcript). They are followed by a poly A tail and were likely introduced by the LINE1 machinery. They could be the result of R-R recombination of a LINE1-retroposed full transcripts, though no full processed psuedogenes of HERV9 with LTR12F LTRs survived. Slight target site duplication preference for MTAK. |
| Sequence |
TGAGAGGTGAAGCCAGCTGGACTTCCTGGGTCGAGTGGGGACTTGGAGAACTTTTCTGTCTTACAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAAACGCACCAATCAGCGCTCTGTAGCTAGCAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCAGGATTCTAAAAGTAGCCAATCGCGGGGAGGATTGAAAAAAGGGCACTCTGATAGGACAGAAACGGAACATGGGAGGGGACAAATAAGGGAATAAAAGCTGGCCACCCCAGCCAGCAGCGGCAACCCGCTCGGGTCCCCTTCCACGCTGTGGAAGCTTTGTTCTTTCGCTCTTCACAATAAACCTTGCTGCCGCTCACTCTTTGGGTCCGTGCCATCTTTAAGAGCTGTAACACTCACCGCGAAGGTCCGCGGCTTCATTCTTGAAGTCAGCGAGACCACGAACCCACCGGNAGGAACCAACTCCGGACACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| LTR12F | KLF17 | 483 | 496 | + | 16.92 | ACCACGAACCCACC |
| LTR12F | MAZ | 279 | 286 | - | 16.08 | CCCCTCCC |
| LTR12F | nfya-1 | 107 | 116 | + | 15.13 | CACCAATCAG |
| LTR12F | nfya-1 | 149 | 158 | + | 15.13 | CACCAATCAG |
| LTR12F | nfya-1 | 173 | 182 | + | 15.13 | CACCAATCAG |
| LTR12F | nfya-1 | 197 | 206 | + | 15.13 | CACCAATCAG |
| LTR12F | nfya-1 | 82 | 91 | + | 15.13 | CACCAATCAG |
| LTR12F | BZIP69 | 11 | 21 | + | 14.89 | AGCCAGCTGGA |
| LTR12F | NFYA | 109 | 116 | + | 14.54 | CCAATCAG |
| LTR12F | NFYA | 151 | 158 | + | 14.54 | CCAATCAG |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
