LTR12F

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000405
TE superfamily ERV1
TE class LTR
Species Catarrhini
Length 519
Kimura value 6.71
Tau index 0.9044
Description Long terminal repeat of class I endogenous retrovirus HERV9
Comment Positions 73-207 of the consensus contains 5 copies of a 23-bp-period tandem repeat interrupted by a 15 bp sequence. The number of units at any locus is variable. Matches limited to pos. ~334 to 411 represent retroposed copies of the region of the LTR between the transcription initiation and termination signals (named R as it Repeats at the ends of the transcript). They are followed by a poly A tail and were likely introduced by the LINE1 machinery. They could be the result of R-R recombination of a LINE1-retroposed full transcripts, though no full processed psuedogenes of HERV9 with LTR12F LTRs survived. Slight target site duplication preference for MTAK.
Sequence
TGAGAGGTGAAGCCAGCTGGACTTCCTGGGTCGAGTGGGGACTTGGAGAACTTTTCTGTCTTACAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAAACGCACCAATCAGCGCTCTGTAGCTAGCAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCAGGATTCTAAAAGTAGCCAATCGCGGGGAGGATTGAAAAAAGGGCACTCTGATAGGACAGAAACGGAACATGGGAGGGGACAAATAAGGGAATAAAAGCTGGCCACCCCAGCCAGCAGCGGCAACCCGCTCGGGTCCCCTTCCACGCTGTGGAAGCTTTGTTCTTTCGCTCTTCACAATAAACCTTGCTGCCGCTCACTCTTTGGGTCCGTGCCATCTTTAAGAGCTGTAACACTCACCGCGAAGGTCCGCGGCTTCATTCTTGAAGTCAGCGAGACCACGAACCCACCGGNAGGAACCAACTCCGGACACA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
LTR12F tin 30 38 + 13.94 GTCGAGTGG
LTR12F Zic1::Zic2 204 210 + 13.93 CAGCAGG
LTR12F BZIP30 12 20 + 13.87 GCCAGCTGG
LTR12F SP4 278 286 + 13.83 TGGGAGGGG
LTR12F ZNF263 233 239 + 13.83 GGGAGGA
LTR12F Zic3 204 210 + 13.70 CAGCAGG
LTR12F ETV1 21 29 - 13.70 CCAGGAAGT
LTR12F Ikzf3 20 28 - 13.67 CAGGAAGTC
LTR12F VIP1 11 20 + 13.64 AGCCAGCTGG
LTR12F ZNF175 21 29 - 13.64 CCAGGAAGT


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).