LTR12F
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000405 |
|---|---|
| TE superfamily | ERV1 |
| TE class | LTR |
| Species | Catarrhini |
| Length | 519 |
| Kimura value | 6.71 |
| Tau index | 0.9044 |
| Description | Long terminal repeat of class I endogenous retrovirus HERV9 |
| Comment | Positions 73-207 of the consensus contains 5 copies of a 23-bp-period tandem repeat interrupted by a 15 bp sequence. The number of units at any locus is variable. Matches limited to pos. ~334 to 411 represent retroposed copies of the region of the LTR between the transcription initiation and termination signals (named R as it Repeats at the ends of the transcript). They are followed by a poly A tail and were likely introduced by the LINE1 machinery. They could be the result of R-R recombination of a LINE1-retroposed full transcripts, though no full processed psuedogenes of HERV9 with LTR12F LTRs survived. Slight target site duplication preference for MTAK. |
| Sequence |
TGAGAGGTGAAGCCAGCTGGACTTCCTGGGTCGAGTGGGGACTTGGAGAACTTTTCTGTCTTACAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAAACGCACCAATCAGCGCTCTGTAGCTAGCAAGAGGATTGTAAAATGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCGCTCTGTAAAACGCACCAATCAGCAGGATTCTAAAAGTAGCCAATCGCGGGGAGGATTGAAAAAAGGGCACTCTGATAGGACAGAAACGGAACATGGGAGGGGACAAATAAGGGAATAAAAGCTGGCCACCCCAGCCAGCAGCGGCAACCCGCTCGGGTCCCCTTCCACGCTGTGGAAGCTTTGTTCTTTCGCTCTTCACAATAAACCTTGCTGCCGCTCACTCTTTGGGTCCGTGCCATCTTTAAGAGCTGTAACACTCACCGCGAAGGTCCGCGGCTTCATTCTTGAAGTCAGCGAGACCACGAACCCACCGGNAGGAACCAACTCCGGACACA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| LTR12F | NFYA | 175 | 182 | + | 14.54 | CCAATCAG |
| LTR12F | NFYA | 199 | 206 | + | 14.54 | CCAATCAG |
| LTR12F | NFYA | 84 | 91 | + | 14.54 | CCAATCAG |
| LTR12F | Sox11 | 363 | 370 | - | 14.51 | GAACAAAG |
| LTR12F | ZNF766 | 384 | 392 | + | 14.38 | AATAAACCT |
| LTR12F | nit-4 | 454 | 460 | + | 14.25 | TCCGCGG |
| LTR12F | HAP5 | 108 | 121 | - | 14.04 | GAGCGCTGATTGGT |
| LTR12F | HAP5 | 150 | 163 | - | 14.04 | GAGCGCTGATTGGT |
| LTR12F | HAP5 | 174 | 187 | - | 14.04 | GAGCGCTGATTGGT |
| LTR12F | HAP5 | 83 | 96 | - | 14.04 | GAGCGCTGATTGGT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
