Helitron3Na_Mam
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000160 |
|---|---|
| TE superfamily | Helitron-1 |
| TE class | RC |
| Species | Eutheria |
| Length | 486 |
| Kimura value | 31.32 |
| Tau index | 0.8210 |
| Description | Helitron DNA transposon, Helitron3Na_Mam subfamily |
| Comment | Helitrons are thought to transpose with a rolling circle mechanism, and represent a distinct class of DNA transposon. Helitron3Na_Mam represents a non-autonomous helitron fossil also found in other mammals, though it is not clearly similar to the other human helitron models. |
| Sequence |
TCTATATAAATAAAATTAAGTTTCTGTCTGTTTGTCTGTTACCGCATCACGCGAAAATGGCTGGATGGATTTTCACCAAATTTGGAGGGTATGTTTGGGATGGTCTGACTTAAAATATAGGCTATGTGGCATACACGAAATTCACTTTGGGGGGCCCTGGGGGGCACCTCAAAGAGATAGGCAGTCATCCTCCAGAGCAGCTGAAACTGAGGTACAACGAGAGGCCCGTGTGACTGCCGATCGGGAGAGACATGCCATACGTATTAAGACGCCGTGGACAGAGAAAACAAACAGTGGTTTCAAATATGAGCCCCAAATCGAAAGTCACAAGGGCAGACGCTCCGAATTGCAGGCGTTGATTTGCGATCGAGCTGCTTCTCACATGGGCAACTCTATGTAGCGTGCTCCAGGGTGAGTAGCAGCAGGGATTTATTTATTTAACGATGGTTAATGATTCTCCCGAGCAACGCCGGGGAGGCCAGCTAG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Helitron3Na_Mam | Nr2F6 | 321 | 335 | + | -6.80 | AAAGTCACAAGGGCA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
