Helitron2Na_Mam

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000159
TE superfamily Helitron-1
TE order RC
Species Theria_mammals
Length 324
Kimura value 33.87
Tau index 1.0000
Description Helitron DNA transposon, Helitron2Na_Mam subfamily
Comment Helitrons are thought to transpose with a rolling circle mechanism, and represent a distinct class of DNA transposon. While named a helitron, this 324bp TE model its classification is tentative. There is suggestive similarity to a non-autonomous helitron in the sea urchin S. purpuratus.
Sequence
TTGACCGAACGAAGTGAGGTCTCTGTTTCAACTCGACCGCTTGGCATTTTGCATTTGTCTGTCTGTTTGTTCCATGATAACTTTCGAAGGAGTTGACTGATTTTGACCAAATTTGGTACACTACTAAAGGGTATCAAGATACACCTTAAGTTCGATTTGTGGTTCAGTCTGCCATCTTGAAACAAAATGGCAGCCGATAAAAGTTTTCAAATGGGCATATCTTCTGTAATTTTTAATAGATTTCAATGAAATTTGGTACGTGGGTAGAGGTTACAGAGATATGTGATTGCACTGAGTGAAGTCTGCAGTTCACAGAACCACTAG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Helitron2Na_Mam Nanog 284 290 - 12.67 GCAATCA
Helitron2Na_Mam WRKY42 91 98 + 12.57 AGTTGACT
Helitron2Na_Mam SEP1 104 116 - 12.54 CCAAATTTGGTCA
Helitron2Na_Mam POU5F1 48 54 - 12.44 ATGCAAA
Helitron2Na_Mam squamosa 104 116 - 12.38 CCAAATTTGGTCA
Helitron2Na_Mam WRKY6 91 98 + 12.36 AGTTGACT
Helitron2Na_Mam elt-7 75 81 + 12.35 TGATAAC
Helitron2Na_Mam MYB108 109 118 - 12.28 TACCAAATTT
Helitron2Na_Mam MYB108 249 258 - 12.28 TACCAAATTT
Helitron2Na_Mam AGL3 107 116 + 12.23 CCAAATTTGG


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).