Helitron2Na_Mam
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000159 |
|---|---|
| TE superfamily | Helitron-1 |
| TE class | RC |
| Species | Theria_mammals |
| Length | 324 |
| Kimura value | 33.87 |
| Tau index | 1.0000 |
| Description | Helitron DNA transposon, Helitron2Na_Mam subfamily |
| Comment | Helitrons are thought to transpose with a rolling circle mechanism, and represent a distinct class of DNA transposon. While named a helitron, this 324bp TE model its classification is tentative. There is suggestive similarity to a non-autonomous helitron in the sea urchin S. purpuratus. |
| Sequence |
TTGACCGAACGAAGTGAGGTCTCTGTTTCAACTCGACCGCTTGGCATTTTGCATTTGTCTGTCTGTTTGTTCCATGATAACTTTCGAAGGAGTTGACTGATTTTGACCAAATTTGGTACACTACTAAAGGGTATCAAGATACACCTTAAGTTCGATTTGTGGTTCAGTCTGCCATCTTGAAACAAAATGGCAGCCGATAAAAGTTTTCAAATGGGCATATCTTCTGTAATTTTTAATAGATTTCAATGAAATTTGGTACGTGGGTAGAGGTTACAGAGATATGTGATTGCACTGAGTGAAGTCTGCAGTTCACAGAACCACTAG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Helitron2Na_Mam | Nanog | 284 | 290 | - | 12.67 | GCAATCA |
| Helitron2Na_Mam | WRKY42 | 91 | 98 | + | 12.57 | AGTTGACT |
| Helitron2Na_Mam | SEP1 | 104 | 116 | - | 12.54 | CCAAATTTGGTCA |
| Helitron2Na_Mam | POU5F1 | 48 | 54 | - | 12.44 | ATGCAAA |
| Helitron2Na_Mam | squamosa | 104 | 116 | - | 12.38 | CCAAATTTGGTCA |
| Helitron2Na_Mam | WRKY6 | 91 | 98 | + | 12.36 | AGTTGACT |
| Helitron2Na_Mam | elt-7 | 75 | 81 | + | 12.35 | TGATAAC |
| Helitron2Na_Mam | MYB108 | 109 | 118 | - | 12.28 | TACCAAATTT |
| Helitron2Na_Mam | MYB108 | 249 | 258 | - | 12.28 | TACCAAATTT |
| Helitron2Na_Mam | AGL3 | 107 | 116 | + | 12.23 | CCAAATTTGG |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
