Helitron2Na_Mam
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000159 |
|---|---|
| TE superfamily | Helitron-1 |
| TE class | RC |
| Species | Theria_mammals |
| Length | 324 |
| Kimura value | 33.87 |
| Tau index | 1.0000 |
| Description | Helitron DNA transposon, Helitron2Na_Mam subfamily |
| Comment | Helitrons are thought to transpose with a rolling circle mechanism, and represent a distinct class of DNA transposon. While named a helitron, this 324bp TE model its classification is tentative. There is suggestive similarity to a non-autonomous helitron in the sea urchin S. purpuratus. |
| Sequence |
TTGACCGAACGAAGTGAGGTCTCTGTTTCAACTCGACCGCTTGGCATTTTGCATTTGTCTGTCTGTTTGTTCCATGATAACTTTCGAAGGAGTTGACTGATTTTGACCAAATTTGGTACACTACTAAAGGGTATCAAGATACACCTTAAGTTCGATTTGTGGTTCAGTCTGCCATCTTGAAACAAAATGGCAGCCGATAAAAGTTTTCAAATGGGCATATCTTCTGTAATTTTTAATAGATTTCAATGAAATTTGGTACGTGGGTAGAGGTTACAGAGATATGTGATTGCACTGAGTGAAGTCTGCAGTTCACAGAACCACTAG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Helitron2Na_Mam | phol | 183 | 192 | - | 2.23 | TGCCATTTTG |
| Helitron2Na_Mam | IRF8 | 18 | 30 | - | -1.54 | TGAAACAGAGACC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
