EuthAT-N1a

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0001194
TE superfamily Tip100
TE order DNA
Species Eutheria
Length 258
Kimura value 28.43
Tau index 0.0000
Description hAT-Tip100 DNA transposon, EuthAT-N1a subfamily
Comment -
Sequence
CAGAGCTGTAACTAGGGCGGGGCGACCGGGGCTTTGCCCCAGGGCACCGAAATTTAGAGGGCGCAAANATTTTAAATAATGATTTTAAAAGCTTAGCACCTAGTTAGCAAGAATAATTAGTTAAAATAGGAAGCTACCAGATGGCGCGCATTGTTAATAACACCCATCTGTGAGCCACATCATGAATTACAAAGTTGATTTGAGGGCGCGTTTCGTGCTGCTTGCCCCGGGCGCCAAAATTGCTAGTTACGGCTCTGC



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
EuthAT-N1a pdm3 113 120 - 13.86 CTAATTAT
EuthAT-N1a efl-1 230 239 + 13.84 GGCGCCAAAA
EuthAT-N1a lin-32 164 171 - 13.81 ACAGATGG
EuthAT-N1a EBF1 36 46 + 13.71 GCCCCAGGGCA
EuthAT-N1a TFAP2E 224 232 + 13.59 GCCCCGGGC
EuthAT-N1a Ebf4 36 46 + 13.57 GCCCCAGGGCA
EuthAT-N1a TFAP2E 224 232 - 13.55 GCCCGGGGC
EuthAT-N1a KLF2 15 22 - 13.55 CCCCGCCC
EuthAT-N1a knrl 9 19 + 13.54 TAACTAGGGCG
EuthAT-N1a Dmrt1 188 196 + 13.53 TACAAAGTT


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).