Eulor9A
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000139 |
|---|---|
| TE superfamily | Transposase |
| TE order | DNA |
| Species | Amniota |
| Length | 301 |
| Kimura value | 26.20 |
| Tau index | 0.0000 |
| Description | Eulor9A (Euteleostomi-conserved low frequency repeat 9A) |
| Comment | Putative DNA transposon (assignment unclear). Present in mammals and birds (>100 copies). Has a hairpin-tail structure typical for all Eulor repeats. However, termini are poorly defined. |
| Sequence |
TAAATTAAATGCAAAAAACTACGTTAATGCAACGTTATGGCTGAGAATTTAAACGCACAAAAGTCAGGAAATTCAAAGTTACGGTTCCCACAGCAACCGTAACTCGGCCCCCTTGCGCATAGNAGTATTTTGTATTACTGTATATGNTGTTAAATTTATGCCTTAATATCAGTATGTGCAATGTGGCCGAGTTACGGTTGCTGTGGGAACCGTAACTTTGAATTTCCTGACTTTTGTGCGTTTAAAATCTCAACCGTAACGTTGCATTAACGTAGGNTTTTTTGCATTTTACTTTCCTTTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor9A | THRB | 213 | 230 | + | 4.00 | TAACTTTGAATTTCCTGA |
| Eulor9A | THRB | 64 | 81 | - | 4.00 | TAACTTTGAATTTCCTGA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
