Eulor6D

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000135
TE superfamily Crypton
TE order DNA
Species Tetrapoda
Length 302
Kimura value 28.95
Tau index 0.0000
Description Eulor6D (Euteleostomi-conserved low frequency repeat 6D)
Comment Putative DNA transposon (assignment unclear). Present in ~100 copies in the human genome, ~100 in platypus, also detected in Xenopus. Position (roughly) 1-162 is an imperfect hairpin.
Sequence
TAATTAAGCAATAAGACACGACAGGCAGTGCATTTCTGGGCGATTATAGCACGCCTCGGGTGGCGTTATAAGGCACGAGGCCGAAGGCCGAGTGACTTTAACCACCCGAGAAGTGCAATAATCGCCCNGAAATGCACTGCCTGGAGTGTCTTATTGCTATTATGAAATGGAATTTATACATAAAAATAAGGAAAACAGTCAGACCCGTGCATTTACTGGGCATTATTGACATGGGCGTGACATCACCGACAGCCAATCAGAAANCTCCGNTTGCGTCCGGNGTTCTAAAGCCGTTTCATAAT



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Eulor6D GLI3 99 113 + 0.42 TAACCACCCGAGAAG
Eulor6D ZNF410 155 170 - -4.60 CCATTTCATAATAGCA
Eulor6D DAL81 49 67 + -52.00 GCACGCCTCGGGTGGCGTT


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).