Eulor5B
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000131 |
|---|---|
| TE superfamily | Crypton-A |
| TE class | DNA |
| Species | Tetrapoda |
| Length | 192 |
| Kimura value | 22.48 |
| Tau index | 0.0000 |
| Description | Eulor5B (Euteleostomi-conserved low frequency repeat 5B) |
| Comment | Putative DNA transposon (assignment unclear). Present in ~50 copies in mammals and chicken, also detected in Xenopus. The sequence is an (imperfect) hairpin. Other members of the Eulor5/6 group all have a non- palindromic region downstream, but this his not been detected in Eulor5B yet. |
| Sequence |
TATTTAAGCAATAATCCCCGAGAAATCGGTCGTTACCAGCAGTTAACGACCGGTTTGTTAGTTAACGGCCCGAGGCGAAGCCGAGGGCGGTTAACGCTCTAACAAACCGGTCGTTAACTGCGGTAACGACCGATTTCGAGGGGATTATTGCTATTATAAACCATANTCAACGGTTTATAACAGCAATAATGT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor5B | FOXO1::ELK3 | 102 | 114 | + | 9.51 | ACAAACCGGTCGT |
| Eulor5B | FOXO1::ELK3 | 46 | 58 | - | 9.51 | ACAAACCGGTCGT |
| Eulor5B | CUP2 | 181 | 191 | + | 9.14 | CAGCAATAATG |
| Eulor5B | IXR1 | 78 | 92 | + | 6.66 | AAGCCGAGGGCGGTT |
| Eulor5B | SNT2 | 29 | 38 | - | 1.40 | TGGTAACGAC |
| Eulor5B | DAL81 | 76 | 94 | + | -51.72 | CGAAGCCGAGGGCGGTTAA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
