Eulor5B
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000131 |
|---|---|
| TE superfamily | Crypton-A |
| TE order | DNA |
| Species | Tetrapoda |
| Length | 192 |
| Kimura value | 22.48 |
| Tau index | 0.0000 |
| Description | Eulor5B (Euteleostomi-conserved low frequency repeat 5B) |
| Comment | Putative DNA transposon (assignment unclear). Present in ~50 copies in mammals and chicken, also detected in Xenopus. The sequence is an (imperfect) hairpin. Other members of the Eulor5/6 group all have a non- palindromic region downstream, but this his not been detected in Eulor5B yet. |
| Sequence |
TATTTAAGCAATAATCCCCGAGAAATCGGTCGTTACCAGCAGTTAACGACCGGTTTGTTAGTTAACGGCCCGAGGCGAAGCCGAGGGCGGTTAACGCTCTAACAAACCGGTCGTTAACTGCGGTAACGACCGATTTCGAGGGGATTATTGCTATTATAAACCATANTCAACGGTTTATAACAGCAATAATGT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor5B | MYBL1 | 87 | 98 | - | 15.03 | AGCGTTAACCGC |
| Eulor5B | TFAP2B | 68 | 76 | + | 14.67 | GCCCGAGGC |
| Eulor5B | TfAP-2 | 68 | 76 | + | 14.21 | GCCCGAGGC |
| Eulor5B | TfAP-2 | 68 | 76 | - | 14.16 | GCCTCGGGC |
| Eulor5B | TFAP2E | 68 | 76 | + | 14.04 | GCCCGAGGC |
| Eulor5B | TFAP2E | 68 | 76 | - | 14.02 | GCCTCGGGC |
| Eulor5B | TFAP2C | 68 | 76 | + | 13.71 | GCCCGAGGC |
| Eulor5B | MYB105 | 168 | 180 | - | 13.63 | TTATAAACCGTTG |
| Eulor5B | VIT_17s0000g10420 | 88 | 95 | - | 13.43 | GTTAACCG |
| Eulor5B | TFAP2B | 68 | 76 | - | 13.40 | GCCTCGGGC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
