Eulor5B

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000131
TE superfamily Crypton-A
TE order DNA
Species Tetrapoda
Length 192
Kimura value 22.48
Tau index 0.0000
Description Eulor5B (Euteleostomi-conserved low frequency repeat 5B)
Comment Putative DNA transposon (assignment unclear). Present in ~50 copies in mammals and chicken, also detected in Xenopus. The sequence is an (imperfect) hairpin. Other members of the Eulor5/6 group all have a non- palindromic region downstream, but this his not been detected in Eulor5B yet.
Sequence
TATTTAAGCAATAATCCCCGAGAAATCGGTCGTTACCAGCAGTTAACGACCGGTTTGTTAGTTAACGGCCCGAGGCGAAGCCGAGGGCGGTTAACGCTCTAACAAACCGGTCGTTAACTGCGGTAACGACCGATTTCGAGGGGATTATTGCTATTATAAACCATANTCAACGGTTTATAACAGCAATAATGT



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Eulor5B MYBL1 110 121 + 11.72 GTCGTTAACTGC
Eulor5B MYBL1 39 50 - 11.72 GTCGTTAACTGC
Eulor5B MYB3R3 63 70 - 11.70 GGCCGTTA
Eulor5B btd 83 91 + 11.58 GAGGGCGGT
Eulor5B MYB65 86 93 - 11.56 TAACCGCC
Eulor5B PITX2 11 18 + 11.54 ATAATCCC
Eulor5B PITX2 141 148 - 11.54 ATAATCCC
Eulor5B Hoxa11 110 118 + 11.53 GTCGTTAAC
Eulor5B Hoxa11 42 50 - 11.53 GTCGTTAAC
Eulor5B Zm00001d005692 184 191 + 11.53 CAATAATG


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).