Eulor5B
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000131 |
|---|---|
| TE superfamily | Crypton-A |
| TE order | DNA |
| Species | Tetrapoda |
| Length | 192 |
| Kimura value | 22.48 |
| Tau index | 0.0000 |
| Description | Eulor5B (Euteleostomi-conserved low frequency repeat 5B) |
| Comment | Putative DNA transposon (assignment unclear). Present in ~50 copies in mammals and chicken, also detected in Xenopus. The sequence is an (imperfect) hairpin. Other members of the Eulor5/6 group all have a non- palindromic region downstream, but this his not been detected in Eulor5B yet. |
| Sequence |
TATTTAAGCAATAATCCCCGAGAAATCGGTCGTTACCAGCAGTTAACGACCGGTTTGTTAGTTAACGGCCCGAGGCGAAGCCGAGGGCGGTTAACGCTCTAACAAACCGGTCGTTAACTGCGGTAACGACCGATTTCGAGGGGATTATTGCTATTATAAACCATANTCAACGGTTTATAACAGCAATAATGT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor5B | Dmbx1 | 138 | 147 | + | 12.26 | GAGGGGATTA |
| Eulor5B | ATHB-51 | 184 | 191 | - | 12.23 | CATTATTG |
| Eulor5B | MZF1 | 139 | 146 | - | 12.16 | AATCCCCT |
| Eulor5B | GT-1 | 88 | 95 | - | 12.13 | GTTAACCG |
| Eulor5B | MYBL1 | 110 | 121 | - | 11.98 | GCAGTTAACGAC |
| Eulor5B | MYBL1 | 39 | 50 | + | 11.98 | GCAGTTAACGAC |
| Eulor5B | Rhox11 | 177 | 185 | - | 11.98 | TGCTGTTAT |
| Eulor5B | HOXC12 | 109 | 118 | + | 11.96 | GGTCGTTAAC |
| Eulor5B | HOXC12 | 42 | 51 | - | 11.96 | GGTCGTTAAC |
| Eulor5B | Gam1 | 86 | 93 | - | 11.84 | TAACCGCC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.