Eulor5B
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000131 |
|---|---|
| TE superfamily | Crypton-A |
| TE order | DNA |
| Species | Tetrapoda |
| Length | 192 |
| Kimura value | 22.48 |
| Tau index | 0.0000 |
| Description | Eulor5B (Euteleostomi-conserved low frequency repeat 5B) |
| Comment | Putative DNA transposon (assignment unclear). Present in ~50 copies in mammals and chicken, also detected in Xenopus. The sequence is an (imperfect) hairpin. Other members of the Eulor5/6 group all have a non- palindromic region downstream, but this his not been detected in Eulor5B yet. |
| Sequence |
TATTTAAGCAATAATCCCCGAGAAATCGGTCGTTACCAGCAGTTAACGACCGGTTTGTTAGTTAACGGCCCGAGGCGAAGCCGAGGGCGGTTAACGCTCTAACAAACCGGTCGTTAACTGCGGTAACGACCGATTTCGAGGGGATTATTGCTATTATAAACCATANTCAACGGTTTATAACAGCAATAATGT
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor5B | TFAP2A | 68 | 76 | - | 13.24 | GCCTCGGGC |
| Eulor5B | MYB70 | 169 | 175 | - | 12.88 | AACCGTT |
| Eulor5B | SWI5 | 35 | 41 | - | 12.85 | TGCTGGT |
| Eulor5B | VIT_17s0000g10420 | 59 | 66 | - | 12.85 | GTTAACTA |
| Eulor5B | OTX2 | 12 | 18 | - | 12.40 | GGGATTA |
| Eulor5B | OTX2 | 141 | 147 | + | 12.40 | GGGATTA |
| Eulor5B | MYBL1 | 58 | 69 | - | 12.38 | GCCGTTAACTAA |
| Eulor5B | TFCP2 | 104 | 112 | + | 12.38 | AAACCGGTC |
| Eulor5B | TFCP2 | 48 | 56 | - | 12.38 | AAACCGGTC |
| Eulor5B | MYBL1 | 87 | 98 | + | 12.36 | GCGGTTAACGCT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.