Eulor2C
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000127 |
|---|---|
| TE superfamily | Transposase |
| TE class | DNA |
| Species | Amniota |
| Length | 168 |
| Kimura value | 26.12 |
| Tau index | 0.0000 |
| Description | Eulor2C (Euteleostomi-conserved low frequency repeat 2C) |
| Comment | Putative DNA transposon (assignment unclear). Distantly related to Eulor2A and 2B. It has a conserved secondary structure. Matches part of the hairpin of Eulor2A & B, but < 75% similar. |
| Sequence |
TANTTAAGGGATAATGTTCACGGCGGAGGAGTATACGAAGCAATAAACGGCTTTTGCGGGTGATTAAACGCCGAAGTGAAGCTGAGGCGTTTGATNAACCGCAAAAGCCGTTTATTGCGAGTATACTCCAATGCCACGAACATTATTCCTATTACACGACAAGANAGA
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor2C | ERF014 | 21 | 35 | - | 9.38 | TATACTCCTCCGCCG |
| Eulor2C | ERF9 | 13 | 31 | + | 8.98 | AATGTTCACGGCGGAGGAG |
| Eulor2C | klu | 22 | 32 | - | 7.69 | ACTCCTCCGCC |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
