Eulor2C

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000127
TE superfamily Transposase
TE order DNA
Species Amniota
Length 168
Kimura value 26.12
Tau index 0.0000
Description Eulor2C (Euteleostomi-conserved low frequency repeat 2C)
Comment Putative DNA transposon (assignment unclear). Distantly related to Eulor2A and 2B. It has a conserved secondary structure. Matches part of the hairpin of Eulor2A & B, but < 75% similar.
Sequence
TANTTAAGGGATAATGTTCACGGCGGAGGAGTATACGAAGCAATAAACGGCTTTTGCGGGTGATTAAACGCCGAAGTGAAGCTGAGGCGTTTGATNAACCGCAAAAGCCGTTTATTGCGAGTATACTCCAATGCCACGAACATTATTCCTATTACACGACAAGANAGA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Eulor2C Cdx 40 47 - 12.76 TTTATTGC
Eulor2C Hoxd13 111 117 - 12.73 CAATAAA
Eulor2C Hoxd13 41 47 + 12.73 CAATAAA
Eulor2C ERF105 20 29 + 12.67 ACGGCGGAGG
Eulor2C IME1 21 28 + 12.66 CGGCGGAG
Eulor2C NUC 153 164 - 12.64 TCTTGTCGTGTA
Eulor2C run 97 104 + 12.59 AACCGCAA
Eulor2C HMRA2 151 158 - 12.52 CGTGTAAT
Eulor2C LEP 19 28 - 12.52 CTCCGCCGTG
Eulor2C IDD7 151 164 + 12.42 ATTACACGACAAGA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).