Eulor2B

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000126
TE superfamily Transposase
TE order DNA
Species Amniota
Length 273
Kimura value 27.92
Tau index 0.0000
Description Eulor2B (Euteleostomi-conserved low frequency repeat 2B)
Comment Putative DNA transposon (assignment unclear). Eulor2B has a 34bp internal deletion relative to Eulor2A. Hairpin (roughly) pos 1-157.
Sequence
TAATTAAGAGATAATGTCAATGGAATAGAACGTTGTCACAGGATAATGGTCTCCCGCTGCTAGATAAATGCCGAGGCGNAAGCCGAGACGTTTATTTTCAAAGCAGGAGACATTGATCCTGTGACAACGTTCTATTACAATGACTTTATTTCTATTATACCAAATGATTGATGTAGATTTAATCATTTTGTCTGATGGATGTTGGTGCAGTAGAGTGACAGNTGCTCGCTGTACCATCGTTGANTTGCTGCGTTCGGATTGGCTTAGAAAACA



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Eulor2B ZSCAN16 115 132 - -20.91 GAACGTTGTCACAGGATC


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).