Eulor1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000121 |
|---|---|
| TE superfamily | Transposase |
| TE order | DNA |
| Species | Amniota |
| Length | 357 |
| Kimura value | 24.84 |
| Tau index | 0.0000 |
| Description | Eulor1 (Euteleostomi-conserved low frequency repeat 1) |
| Comment | Eulor1 forms a near-perfect hairpin and is present in the chicken (~80 copies) and mammalian genomes (100-150 copies). It may represent an incomplete non-autonomous DNA transposon or a mixture of related DNA transposons of different length. |
| Sequence |
CAGCAGGCCGGATTCATCAAAAGGATAACGGGTAGATATTTTCCGTTTGTNGAATTTTAACGAATAAACGGCATTTCTATTCGTTATTTATCTACTTTCGAATTTTAACGAATAGTTCTAGTGATAATTACCGAATTTCTATATTTATAGAAAACCGGCACTTCATAAATATCGAATTGTGCTATTATCTACATATGTGCCGGTTTTCTATAAATATAGAAATTCGGTAATTATCACTAGAACTATTCGTTAAAATTCGAAAGTAGATAAATAACGAATAGGAATGCCATTTATTCGTTAAAATTCTACAAAANAAAAATATCTNCCCGTTATCCCTTTGATGAATTCGGCCCATTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor1 | ttk | 21 | 29 | + | 13.88 | AAGGATAAC |
| Eulor1 | Zic3 | 1 | 7 | + | 13.70 | CAGCAGG |
| Eulor1 | Hnf1A | 335 | 344 | + | 13.29 | CCTTTGATGA |
| Eulor1 | AT1G76870 | 151 | 158 | + | 13.27 | AAAACCGG |
| Eulor1 | AT1G76870 | 200 | 207 | - | 13.27 | AAAACCGG |
| Eulor1 | HMRA1 | 176 | 182 | - | 12.91 | GCACAAT |
| Eulor1 | NFATC4 | 38 | 46 | - | 12.90 | ACGGAAAAT |
| Eulor1 | AGL27 | 135 | 148 | + | 12.63 | ATTTCTATATTTAT |
| Eulor1 | AGL27 | 210 | 223 | - | 12.63 | ATTTCTATATTTAT |
| Eulor1 | TCF7 | 336 | 342 | + | 12.42 | CTTTGAT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
