Eulor1

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000121
TE superfamily Transposase
TE order DNA
Species Amniota
Length 357
Kimura value 24.84
Tau index 0.0000
Description Eulor1 (Euteleostomi-conserved low frequency repeat 1)
Comment Eulor1 forms a near-perfect hairpin and is present in the chicken (~80 copies) and mammalian genomes (100-150 copies). It may represent an incomplete non-autonomous DNA transposon or a mixture of related DNA transposons of different length.
Sequence
CAGCAGGCCGGATTCATCAAAAGGATAACGGGTAGATATTTTCCGTTTGTNGAATTTTAACGAATAAACGGCATTTCTATTCGTTATTTATCTACTTTCGAATTTTAACGAATAGTTCTAGTGATAATTACCGAATTTCTATATTTATAGAAAACCGGCACTTCATAAATATCGAATTGTGCTATTATCTACATATGTGCCGGTTTTCTATAAATATAGAAATTCGGTAATTATCACTAGAACTATTCGTTAAAATTCGAAAGTAGATAAATAACGAATAGGAATGCCATTTATTCGTTAAAATTCTACAAAANAAAAATATCTNCCCGTTATCCCTTTGATGAATTCGGCCCATTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Eulor1 ttk 21 29 + 13.88 AAGGATAAC
Eulor1 Zic3 1 7 + 13.70 CAGCAGG
Eulor1 Hnf1A 335 344 + 13.29 CCTTTGATGA
Eulor1 AT1G76870 151 158 + 13.27 AAAACCGG
Eulor1 AT1G76870 200 207 - 13.27 AAAACCGG
Eulor1 HMRA1 176 182 - 12.91 GCACAAT
Eulor1 NFATC4 38 46 - 12.90 ACGGAAAAT
Eulor1 AGL27 135 148 + 12.63 ATTTCTATATTTAT
Eulor1 AGL27 210 223 - 12.63 ATTTCTATATTTAT
Eulor1 TCF7 336 342 + 12.42 CTTTGAT


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).