Eulor1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000121 |
|---|---|
| TE superfamily | Transposase |
| TE class | DNA |
| Species | Amniota |
| Length | 357 |
| Kimura value | 24.84 |
| Tau index | 0.0000 |
| Description | Eulor1 (Euteleostomi-conserved low frequency repeat 1) |
| Comment | Eulor1 forms a near-perfect hairpin and is present in the chicken (~80 copies) and mammalian genomes (100-150 copies). It may represent an incomplete non-autonomous DNA transposon or a mixture of related DNA transposons of different length. |
| Sequence |
CAGCAGGCCGGATTCATCAAAAGGATAACGGGTAGATATTTTCCGTTTGTNGAATTTTAACGAATAAACGGCATTTCTATTCGTTATTTATCTACTTTCGAATTTTAACGAATAGTTCTAGTGATAATTACCGAATTTCTATATTTATAGAAAACCGGCACTTCATAAATATCGAATTGTGCTATTATCTACATATGTGCCGGTTTTCTATAAATATAGAAATTCGGTAATTATCACTAGAACTATTCGTTAAAATTCGAAAGTAGATAAATAACGAATAGGAATGCCATTTATTCGTTAAAATTCTACAAAANAAAAATATCTNCCCGTTATCCCTTTGATGAATTCGGCCCATTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor1 | RVE4 | 316 | 324 | - | 16.53 | AGATATTTT |
| Eulor1 | RVE4 | 34 | 42 | + | 16.53 | AGATATTTT |
| Eulor1 | RVE7 | 316 | 324 | + | 16.38 | AAAATATCT |
| Eulor1 | RVE7 | 34 | 42 | - | 16.38 | AAAATATCT |
| Eulor1 | RVE6 | 316 | 324 | - | 16.23 | AGATATTTT |
| Eulor1 | RVE6 | 34 | 42 | + | 16.23 | AGATATTTT |
| Eulor1 | RVE5 | 316 | 324 | - | 16.21 | AGATATTTT |
| Eulor1 | RVE5 | 34 | 42 | + | 16.21 | AGATATTTT |
| Eulor1 | RVE8 | 316 | 324 | - | 16.08 | AGATATTTT |
| Eulor1 | RVE8 | 34 | 42 | + | 16.08 | AGATATTTT |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
