Eulor1

Basic information Differential Expression Stage analysis Survival analysis Correlation analysis

DF ID DF0000121
TE superfamily Transposase
TE order DNA
Species Amniota
Length 357
Kimura value 24.84
Tau index 0.0000
Description Eulor1 (Euteleostomi-conserved low frequency repeat 1)
Comment Eulor1 forms a near-perfect hairpin and is present in the chicken (~80 copies) and mammalian genomes (100-150 copies). It may represent an incomplete non-autonomous DNA transposon or a mixture of related DNA transposons of different length.
Sequence
CAGCAGGCCGGATTCATCAAAAGGATAACGGGTAGATATTTTCCGTTTGTNGAATTTTAACGAATAAACGGCATTTCTATTCGTTATTTATCTACTTTCGAATTTTAACGAATAGTTCTAGTGATAATTACCGAATTTCTATATTTATAGAAAACCGGCACTTCATAAATATCGAATTGTGCTATTATCTACATATGTGCCGGTTTTCTATAAATATAGAAATTCGGTAATTATCACTAGAACTATTCGTTAAAATTCGAAAGTAGATAAATAACGAATAGGAATGCCATTTATTCGTTAAAATTCTACAAAANAAAAATATCTNCCCGTTATCCCTTTGATGAATTCGGCCCATTG



TF motifs of the concenus sequence

Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.

TE_family TFBS Start End Strand Score Matched sequence
Eulor1 PK02532.1 317 324 + 14.19 AAATATCT
Eulor1 PK02532.1 34 41 - 14.19 AAATATCT
Eulor1 Lef1 335 342 + 14.17 CCTTTGAT
Eulor1 AP1 136 148 - 14.06 ATAAATATAGAAA
Eulor1 AP1 210 222 + 14.06 ATAAATATAGAAA
Eulor1 Crg-1 264 274 + 13.97 TAGATAAATAA
Eulor1 Crg-1 84 94 - 13.97 TAGATAAATAA
Eulor1 Zic1::Zic2 1 7 + 13.93 CAGCAGG
Eulor1 TCX2 248 262 + 13.90 CGTTAAAATTCGAAA
Eulor1 TCX2 96 110 - 13.90 CGTTAAAATTCGAAA


TFBS enrichment in GRCh38

Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.




GTEx

The promoter activity across 46 body sites from The Genotype-Tissue Expression (GTEx) project.




TCGA

The promoter activity across 33 cancer types from The Cancer Genome Atlas (TCGA).