Eulor1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysis| DF ID | DF0000121 |
|---|---|
| TE superfamily | Transposase |
| TE class | DNA |
| Species | Amniota |
| Length | 357 |
| Kimura value | 24.84 |
| Tau index | 0.0000 |
| Description | Eulor1 (Euteleostomi-conserved low frequency repeat 1) |
| Comment | Eulor1 forms a near-perfect hairpin and is present in the chicken (~80 copies) and mammalian genomes (100-150 copies). It may represent an incomplete non-autonomous DNA transposon or a mixture of related DNA transposons of different length. |
| Sequence |
CAGCAGGCCGGATTCATCAAAAGGATAACGGGTAGATATTTTCCGTTTGTNGAATTTTAACGAATAAACGGCATTTCTATTCGTTATTTATCTACTTTCGAATTTTAACGAATAGTTCTAGTGATAATTACCGAATTTCTATATTTATAGAAAACCGGCACTTCATAAATATCGAATTGTGCTATTATCTACATATGTGCCGGTTTTCTATAAATATAGAAATTCGGTAATTATCACTAGAACTATTCGTTAAAATTCGAAAGTAGATAAATAACGAATAGGAATGCCATTTATTCGTTAAAATTCTACAAAANAAAAATATCTNCCCGTTATCCCTTTGATGAATTCGGCCCATTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
| TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
|---|---|---|---|---|---|---|
| Eulor1 | LHY | 316 | 324 | - | 15.86 | AGATATTTT |
| Eulor1 | LHY | 34 | 42 | + | 15.86 | AGATATTTT |
| Eulor1 | RVE1 | 316 | 324 | + | 15.59 | AAAATATCT |
| Eulor1 | RVE1 | 34 | 42 | - | 15.59 | AAAATATCT |
| Eulor1 | RVE7L | 316 | 324 | + | 15.47 | AAAATATCT |
| Eulor1 | RVE7L | 34 | 42 | - | 15.47 | AAAATATCT |
| Eulor1 | CCA1 | 317 | 324 | + | 14.72 | AAATATCT |
| Eulor1 | CCA1 | 34 | 41 | - | 14.72 | AAATATCT |
| Eulor1 | squamosa | 136 | 148 | - | 14.41 | ATAAATATAGAAA |
| Eulor1 | squamosa | 210 | 222 | + | 14.41 | ATAAATATAGAAA |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.
