Eulor1
Basic information Differential Expression Stage analysis Survival analysis Correlation analysisDF ID | DF0000121 |
---|---|
TE superfamily | Transposase |
TE class | DNA |
Species | Amniota |
Length | 357 |
Kimura value | 24.84 |
Tau index | 0.0000 |
Description | Eulor1 (Euteleostomi-conserved low frequency repeat 1) |
Comment | Eulor1 forms a near-perfect hairpin and is present in the chicken (~80 copies) and mammalian genomes (100-150 copies). It may represent an incomplete non-autonomous DNA transposon or a mixture of related DNA transposons of different length. |
Sequence |
CAGCAGGCCGGATTCATCAAAAGGATAACGGGTAGATATTTTCCGTTTGTNGAATTTTAACGAATAAACGGCATTTCTATTCGTTATTTATCTACTTTCGAATTTTAACGAATAGTTCTAGTGATAATTACCGAATTTCTATATTTATAGAAAACCGGCACTTCATAAATATCGAATTGTGCTATTATCTACATATGTGCCGGTTTTCTATAAATATAGAAATTCGGTAATTATCACTAGAACTATTCGTTAAAATTCGAAAGTAGATAAATAACGAATAGGAATGCCATTTATTCGTTAAAATTCTACAAAANAAAAATATCTNCCCGTTATCCCTTTGATGAATTCGGCCCATTG
|
TF motifs of the concenus sequence
Use FIMO to detect transcription factor motifs in the concenus sequence of the TE family.
TE_family | TFBS | Start | End | Strand | Score | Matched sequence |
---|---|---|---|---|---|---|
Eulor1 | MEF2D | 209 | 220 | + | 5.96 | TATAAATATAGA |
Eulor1 | RLM1 | 137 | 150 | + | 5.60 | TTCTATATTTATAG |
Eulor1 | RLM1 | 208 | 221 | - | 5.60 | TTCTATATTTATAG |
TFBS enrichment in GRCh38
Use Fisher's exact test to perform enrichment analysis of transcription factor binding sites in the TE family of GRCh38.